S17-RNase, FJ602078.1-S17-RNase.m1 (mRNA) Prunus mume

Unique NameFJ602078.1-S17-RNase.m1
OrganismPrunus mume ()

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S17-RNaseS17-RNasePrunus mumegene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
FJ602078.1-S17-RNase.m1-cds1FJ602078.1-S17-RNase.m1-cds1Prunus mumeCDS
FJ602078.1-S17-RNase.m1-cds2FJ602078.1-S17-RNase.m1-cds2Prunus mumeCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S17-RNaseFJ602078.1-S17-RNase.p1Prunus mumepolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
FJ602078 region FJ602078:1..1794+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>FJ602078.1-S17-RNase.m1 ID=FJ602078.1-S17-RNase.m1|Name=S17-RNase|organism=Prunus mume|type=mRNA|length=167bp
back to top

protein sequence of S17-RNase

>FJ602078.1-S17-RNase.p1 ID=FJ602078.1-S17-RNase.p1|Name=S17-RNase|organism=Prunus mume|type=polypeptide|length=55bp
back to top

mRNA from alignment at FJ602078:1..1794+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>FJ602078.1-S17-RNase.m1 ID=FJ602078.1-S17-RNase.m1|Name=S17-RNase|organism=Prunus mume|type=mRNA|length=1794bp|location=Sequence derived from alignment at FJ602078:1..1794+ (Prunus mume)
ctatggccaagtaattattcaaacccaacgatgcccagtaattgcagggg gtctcaatttgatgcaaggaatttggtatgtactgtttcatttcttcttc gtttactctttggtatttagtttatagaaaatcagtttttagacaatata tacctaagtataaaattataagtactatatttatattaatatacctactt agcaataccctgtgaactaatacaattgagggatcttttgtccattcacc caaacaccaaaccctaaattcaggataaaaccgacatttcttggctccta atatatcgggaccaattcctccctaaaagggtgacgtagcgcacatagaa aaactctttgactctgttggtttttaactcaggctcttcctctctgtatt tctagtcggcaaacactgaactccatccaaccaccggcgaactcctctca gcactacccacccaccaccggtcaactcccctagtcacccaacacccaag ccgacaccccagccaccttcgtcccccaccatgttgctggaattactcta acaccccatcctcccccagccagctaccatcttgcccaacgcaccacaac ccacctagcccctggaattactcgccgcacttaacacaccagcctcccta tctttctttctctcccttttccgatgaaccacaacccactctccctagcg caccaaaccctatacccaccttctccggccaacccataccccatcttccc cagtacaaccacacccgacaccagttctgatctgggtctggctcaaatat cttgtaatcgccgggtctaatctgggtccttctggtatgtgagataagga agagagagatggcggtggtggtggttttagatgttgggcagagatagagg ggtgacatttttttagatggttgttttctaaatgtgccacgttatctttt aaggaggaattgctgctgatatagcccagcaatgtccgatctaagaaact atctctaacttttgaagacctttcttattaagaaggaagataatatactt aactcacatatattacatgaatattaaaatttgaattcaaaaccctactc taaaccactaaaataatggatcctttcccttaacatcaaagatgttaagt ggtaaaattgaaaagccataataatatcgcaatcacacgtaaacacaaag agagttgtgcaatcgatcccctattcggctgcttacctccccttatatac aatcttaagccgacacttcccttgggcctaagagcatggcagcccatggg ggcccaatttcttagaggctgaaaacccatgtcaacaaagtggaatttaa cataatagaaggcaaggaacattgtaattttttttttagaggacttttct tattgagaagggtgataatatactaaacttacacacactacacatatatt atggttcgaacctataaccgagcatttgctccaaatcactacactagtgg gtcctttgtcttttttttaatgttttaaaagttaaagaggttgaaaacta aattcataggacatggatatgatctggtgtacctaccattttgtaaggat gataattaaaattaaatttattactcaggtttaatgaaggaaaagaaaca gtcttatccaataatttctcaatatatgtttgtattgctttggatgtctc agtcccctcgattgcaatccaaactgaagaggtcttggcccgacgtggaa agtagcaatgatacaaggttttgggaaggcgaatggaacaaaca
back to top

Coding sequence (CDS) from alignment at FJ602078:1..1794+

>FJ602078.1-S17-RNase.m1 ID=FJ602078.1-S17-RNase.m1|Name=S17-RNase|organism=Prunus mume|type=CDS|length=167bp|location=Sequence derived from alignment at FJ602078:1..1794+ (Prunus mume)
back to top