CBFA, HM099907.1-CBFA.m1 (mRNA) Prunus mume

Unique NameHM099907.1-CBFA.m1
OrganismPrunus mume ()

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
CBFACBFAPrunus mumegene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM099907.1-CBFA.m1-cds1HM099907.1-CBFA.m1-cds1Prunus mumeCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
CBFAHM099907.1-CBFA.p1Prunus mumepolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
HM099907 region HM099907:1..366+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>HM099907.1-CBFA.m1 ID=HM099907.1-CBFA.m1|Name=CBFA|organism=Prunus mume|type=mRNA|length=366bp
back to top

protein sequence of CBFA

>HM099907.1-CBFA.p1 ID=HM099907.1-CBFA.p1|Name=CBFA|organism=Prunus mume|type=polypeptide|length=121bp
back to top

mRNA from alignment at HM099907:1..366+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM099907.1-CBFA.m1 ID=HM099907.1-CBFA.m1|Name=CBFA|organism=Prunus mume|type=mRNA|length=366bp|location=Sequence derived from alignment at HM099907:1..366+ (Prunus mume)
ttacaggggcgtgaggagaaggaacaacaacaagtgggcgtgtgagttga gagagcccaacaagaagaaatcaaggatttggcttggaacgtatccgact gctgagatggctgctcgtgcatatgacgtggcggcattggctttcagagg gaagcttgcctgcataaactttgctgactccgcatggcggctgcccttgc cggcttccatggataccatggatatccgaagggcagccgctggggccgcc gaagggttcaggccagcggagttcggtggattatccagctgcagcagtga tgagaaggagaagatttttagcgtggatatggaaaaaagcagcagcagct tgtgcttgttttattt
back to top

Coding sequence (CDS) from alignment at HM099907:1..366+

>HM099907.1-CBFA.m1 ID=HM099907.1-CBFA.m1|Name=CBFA|organism=Prunus mume|type=CDS|length=366bp|location=Sequence derived from alignment at HM099907:1..366+ (Prunus mume)
back to top