S17-RNase, S17-RNase (gene) Prunus mume

Gene Overview
Name S17-RNase
Gene Symbol S17-RNase
Type gene
Organism Prunus mume
Synonym S17-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S17-RNaseFJ602078.1-S17-RNase.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus mumegene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FJ602078.1-S17-RNase.m1 N/A FJ602078.1

Sequence(s):
>FJ602078.1-S17-RNase.m1167
ctatggccaagtaattattcaaacccaacgatgcccagtaattgcagggggtctcaatttgatgcaaggaatttgtcccc
tcgattgcaatccaaactgaagaggtcttggcccgacgtggaaagtagcaatgatacaaggttttgggaaggcgaatgga
acaaaca
back to top