EH2, EH2 (gene) Prunus persica

Gene Overview
Name EH2
Gene Symbol EH2
Type gene
Organism Prunus persica
Synonym epoxide hydrolase 2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
EH2FN430417.1-EH2.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
epoxide hydrolaseEHPrunus persicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FN430417.1-EH2.m1 scaffold_8:21406986..21409021
FN430417.1

Sequence(s):
>FN430417.1-EH2.m1951
atggagaaaattgagcacacaacggtaagcacaaacggcataaacatgcacatagcgtcaatcggtacaggcccagttgt
gctcttcctccatggattcccggagctctggtactcatggcgccaccagctcctttctctctcatccttgggctaccgtt
gcatagcccctgacctccgaggcttcggtgacaccgacgcaccaccttcccctgcctcctactcggccctgcacatagtt
ggtgacctcattggcctccttgaccatctgggtattgaccaagtcttcttggtcggccatgactggggcgccgtcattgc
ctggtggttctgcttgttcaggcctgaccgagtcaaggccttggtcaacatgagtgtggccttcagtcccaggaacccaa
agagaaagcctgtcgatggtttcagggccttgttcggtgatgattactatatttgcaggttccaggaacctggggagatc
gaaaaagaatttgctggttatgatactacatcaataatgaaaaagtttcttactggtcgtagtccaaaacctccatgcct
acctaaagaactaggattaagagcttggaaaactccagaaaccttgcccccttggctgtcagaagaggaccttaattatt
ttgccagcaaattcagcaagacggggtttgttggtggattgaactattatcgagctttgaacttaacctgggagcttaca
ggaccatggacagggctacaggtcaaagtaccggtcaagtttattgtgggcgacctggacatcacctatcatatcccagg
cgtgaagaactatatacataatggaggcttcaaaagagatgtgccatttttgcaagaggtggttgtgattgaagatggag
ctcactttattaaccaggaaaggcccgacgaaatcagtcggcacgtatatgacttcatccagaagttctga
back to top