S3-RNase, S3-RNase (gene) Prunus persica

Gene Overview
Name S3-RNase
Gene Symbol S3-RNase
Type gene
Organism Prunus persica
Synonym S-ribonuclease 3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB537563.1-S3-RNasePrunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
S3-RNaseAB537563.1-S3-RNase.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus persicagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB537563.1-S3-RNase N/A AB537563.1
mRNA parsed from NCBI nr database AB537563.1-S3-RNase.m1 N/A AB537563.1

Sequence(s):
>AB537563.1-S3-RNase1197
atggggatgctgaaattgtcactcgctttccttgttcttgcttttgctttcttcttgtgtttcattatgagcgctggtga
tggtgggttgcgttacaatcgtttgctctatatatctacatgcatataatcagcattgcttttttctactcgtatttttt
gttcagggaaactattgtgtgtattcgatgatatatcacatgacatgcggtgtattgcattcacccacatatttatcatt
taatctaacgcacaactttctttggataagtaagtattggggattgcttttctgcatgtcctctttttatttgcatccct
ttttttttattctgataattgttgcaataagcgtagcctattcatcacaataattttggcaggatcttacaactattttc
aatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctccaacccccggccattacaatat
ttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgcaatgggtcaaaatttgagga
caggaaagtggtatgtattgtttcattatttttttacttactctttagttggaaaagtggaccgccaggcacgtatattt
acaataatgaatctgatcatctaatcaaaggatcaaaattcaagattcaatatttaatgaaaaaaaacaaaaacaatctc
atccaaaaatgaaagtctatttttttctaaaaatatgtatatattgcttggatgtctcagtaccctaaattgcgagccaa
actgaagaaatcttggccggacgtggaaagcggtaatgatacaagattttgggaaggcgaatggaacaaacatggtacat
gttccgaacagacacttaaccaaatgcaatacttcgagagatcccacgcattttggaacatgcgcaatattacagaaatc
cttaaaaacgcttcaatcgtaccaagtgcgacacagacgtggagctacgcggacatagtatcacctattaaagcagtaac
tcaaaaaacacccctccttcgttgcaaaagtaatccagcaactaatactgagttgttacatgaagtggtattttgttatg
aatataatgccttaaagctgattgactgtaatcgaacagcaggatgcaaaaatcaacaacgcatctcgtttcaataa
back to top
>AB537563.1-S3-RNase.m1687
atggggatgctgaaattgtcactcgctttccttgttcttgcttttgctttcttcttgtgtttcattatgagcgctggtga
tggatcttacaactattttcaatttgtgcaacaatggccaccgaccaactgcagagttcgcatcaagcgaccttgctcca
acccccggccattacaatatttcaccatccatggcctatggccaagtaattattcaaacccaacgaagcccagtaattgc
aatgggtcaaaatttgaggacaggaaagtgtaccctaaattgcgagccaaactgaagaaatcttggccggacgtggaaag
cggtaatgatacaagattttgggaaggcgaatggaacaaacatggtacatgttccgaacagacacttaaccaaatgcaat
acttcgagagatcccacgcattttggaacatgcgcaatattacagaaatccttaaaaacgcttcaatcgtaccaagtgcg
acacagacgtggagctacgcggacatagtatcacctattaaagcagtaactcaaaaaacacccctccttcgttgcaaaag
taatccagcaactaatactgagttgttacatgaagtggtattttgttatgaatataatgccttaaagctgattgactgta
atcgaacagcaggatgcaaaaatcaacaacgcatctcgtttcaataa
back to top