DREB, DREB (gene) Prunus pseudocerasus

Gene Overview
Name DREB
Gene Symbol DREB
Type gene
Organism Prunus pseudocerasus
Synonym dehydration responsive element-binding protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
DREBKM215612.1-DREB.m1Prunus pseudocerasusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
dehydration-responsive element-binding proteinDREBPrunus pseudocerasusgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KM215612.1-DREB.m1 N/A KM215612.1

Sequence(s):
>KM215612.1-DREB.m1720
atggacatgttctccgctcagctttccaactcccccgaccagcccgagtcgagttctttctccgacgccagcgtcatcac
cctaccggcttcttcctccgacgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggaggagggttttca
aggagacgaggcacccggtttacaggggcgtgaggagaaggaacaacaacaagtgggtgtgtgagttgagagagcccaac
aagaagaagtcaagggtttggctcggaacgtatccaacggctgagatggctgctcgtgcccatgacgtggcggcattggc
gttcagggggaagcttgcctgcataaactttgctgactccgcatggcggctacccgtgccggcttccatggataccatgg
atatccgaagggcagctgctgaggcggccgaagggttcaggccagaggagttcggtggattatccagcgggagcagtgat
gagaaggagataaatgttgtgatggaagagaagaagaagaattttagcgtggatatggaaataagcagcagcttgagctt
gttttatttggatgaggaggaaatgtttgatatgccaaggttgattgataacatggccgaagggcttcttctttctccac
ctcaatgcttagctggctacttgaactgggatgacatggaaactgaagctgatcccaaattgtggagtttctcaatctga
back to top