Sg-RNase, Sg-RNase (gene) Prunus salicina

Gene Overview
Name Sg-RNase
Gene Symbol Sg-RNase
Type gene
Organism Prunus salicina
Synonym Sg-RNase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
putative self-incompatibility S-RNaseS-RNasePrunus salicinagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
Sg-RNaseAB093131.1-Sg-RNase.m1Prunus salicinamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB093131.1-Sg-RNase.m1 N/A AB093131.1

Sequence(s):
>AB093131.1-Sg-RNase.m1239
ccatggaagcccagtaattgcagtgggtcgcaatttaaggacgggaaagtgtaccctcagttgcgatccaaattgaagaa
atcttggcctgacgtggaaagtgggaatgatacaaaattttgggaaggcgaatggaacaaacatggtacatgttccgaag
agaaactaaaccaaatgcaatacttcgagcgatcccacaacatgtggaggtcgtacaatattacagaggtccttaaaaa
back to top