S34-RNase, DQ224345.1-S34-RNase.m1 (mRNA) Pyrus pyrifolia

Unique NameDQ224345.1-S34-RNase.m1
OrganismPyrus pyrifolia ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
S34-RNaseDQ224345.1-S34-RNasePyrus pyrifoliagene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S34-RNaseS34-RNasePyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
DQ224345.1-S34-RNase.m1-cds1DQ224345.1-S34-RNase.m1-cds1Pyrus pyrifoliaCDS
DQ224345.1-S34-RNase.m1-cds2DQ224345.1-S34-RNase.m1-cds2Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S34-RNaseDQ224345.1-S34-RNase.p1Pyrus pyrifoliapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
DQ224345 region DQ224345:1..428+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>DQ224345.1-S34-RNase.m1 ID=DQ224345.1-S34-RNase.m1|Name=S34-RNase|organism=Pyrus pyrifolia|type=mRNA|length=201bp
back to top

protein sequence of S34-RNase

>DQ224345.1-S34-RNase.p1 ID=DQ224345.1-S34-RNase.p1|Name=S34-RNase|organism=Pyrus pyrifolia|type=polypeptide|length=67bp
back to top

mRNA from alignment at DQ224345:1..428+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>DQ224345.1-S34-RNase.m1 ID=DQ224345.1-S34-RNase.m1|Name=S34-RNase|organism=Pyrus pyrifolia|type=mRNA|length=428bp|location=Sequence derived from alignment at DQ224345:1..428+ (Pyrus pyrifolia)
tttacgcagcaatatcagccggctgtctgcaactctaaccctactccttg taaggattctccagacaagttgtttacggttcacggcttgtggccttcaa actcgagtggacctcacccacataattgcacgaatacaaccgtgaaatct cagacggtaatattattgataatcagatattgttagattagtcattgacg gggtttgaacccacgtcatcatgcaaagtttcaacatctttccgcgactg tagtaaagagctacttgcttatttcatatatacatatactcaacatagat tttcatgcaagagtgtgcaaatattacaattaatttaaaatttaatcata attatttttctcttatttatattatattgtcagataagatcactcaaagc ccagttggaaattatttggccgaacgta
back to top

Coding sequence (CDS) from alignment at DQ224345:1..428+

>DQ224345.1-S34-RNase.m1 ID=DQ224345.1-S34-RNase.m1|Name=S34-RNase|organism=Pyrus pyrifolia|type=CDS|length=201bp|location=Sequence derived from alignment at DQ224345:1..428+ (Pyrus pyrifolia)
back to top