S43-RNase, EF643643.1-S43-RNase.m1 (mRNA) Pyrus pyrifolia

Unique NameEF643643.1-S43-RNase.m1
OrganismPyrus pyrifolia ()

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S43-RNaseS43-RNasePyrus pyrifoliagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF643643.1-S43-RNase.m1-cds1EF643643.1-S43-RNase.m1-cds1Pyrus pyrifoliaCDS
EF643643.1-S43-RNase.m1-cds2EF643643.1-S43-RNase.m1-cds2Pyrus pyrifoliaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S43-RNaseEF643643.1-S43-RNase.p1Pyrus pyrifoliapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EF643643 region EF643643:29..953+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>EF643643.1-S43-RNase.m1 ID=EF643643.1-S43-RNase.m1|Name=S43-RNase|organism=Pyrus pyrifolia|type=mRNA|length=633bp
back to top

protein sequence of S43-RNase

>EF643643.1-S43-RNase.p1 ID=EF643643.1-S43-RNase.p1|Name=S43-RNase|organism=Pyrus pyrifolia|type=polypeptide|length=211bp
back to top

mRNA from alignment at EF643643:29..953+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF643643.1-S43-RNase.m1 ID=EF643643.1-S43-RNase.m1|Name=S43-RNase|organism=Pyrus pyrifolia|type=mRNA|length=925bp|location=Sequence derived from alignment at EF643643:29..953+ (Pyrus pyrifolia)
atggggattacggggatgatatatatggttacgatggtattttcattaat tgcattaatattgtcttcatccaaggcgcaatatgattattttcaattta cgcagcaatatcagccggctgcctgcaactctaatcctactccttgtaag gatcctccagacaagttgtttacggttcatggtttgtggccttcaaactc gagtggacctcacccacataattgcacaaatacaaccttgaatgctcaga cggtaatattattgataatcagatagtcaatattgtttatttcatttata cgttttttttttttttgtaaaatgatatattttgttagatttgatgttag attagccattgatgggatttgaacccacgtcgtcatgtaaagattcaaca catttccagtactgtagtaaggggccacttgcttatttcataaatacata cactcaacatagattttcatgcaagcgtgtgcaaatattacaattaattt aaaacttaatcataatttttttctattatttatattaatgtcagataaaa tcactcaaagcccagttggaaattatttggccgaacgtactcaatcgaaa cgatcatgtagggttctggcgtagacagtggggcaaacatggcgcctgtg cgtctcccgcattgaagaccgacatgcagtactttcaaacagtaatcaaa atgtacataacccagaaacaaaacgtctcaaaaatcctctcaaaggcgaa tattaaaccgaatgggacaaccaaggcactgacggatatccaaaatgcga tacgcaatggtaacaacaatacgatgccaaaactcaagtgcaaaaataat tctgggatacctgaattggttgaggtcggtttttgcagcgatagcaactt aacacagttcagaaactgccccagc
back to top

Coding sequence (CDS) from alignment at EF643643:29..953+

>EF643643.1-S43-RNase.m1 ID=EF643643.1-S43-RNase.m1|Name=S43-RNase|organism=Pyrus pyrifolia|type=CDS|length=633bp|location=Sequence derived from alignment at EF643643:29..953+ (Pyrus pyrifolia)
back to top