GAPDH-1, GAPDH-1 (gene) Pyrus pyrifolia var. culta

Gene Overview
Name GAPDH-1
Gene Symbol GAPDH-1
Type gene
Organism Pyrus pyrifolia var. culta
Synonym glyceraldehyde-3-phosphate dehydrogenase like protein
PsGAPDH-1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHPyrus pyrifolia var. cultagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDH-1AB266449.1-GAPDH-1.m1Pyrus pyrifolia var. cultamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB266449.1-GAPDH-1.m1 scaffold00586:126252..127963
AB266449.1

Sequence(s):
>AB266449.1-GAPDH-1.m1733
ttgagctagttgctgttaatgatcccttcatcaccaccgactacatgacctacatgttcaagtacgacacagtccatggc
gcatggaagcaccatgagctcaaggtcaaggactccaagacccttctcttcggtgagaagcctgttgctgttttcggaat
caggaacccagaggagatcccatggggtgagaccggtgctgactttgttgttgagtctaccggtgtcttcaccgacaagg
agaaagctgctgcccatatcaagggaggtgcaaagaaggttatcatctctgctcccagcaaggatgctcccatgttcgtt
gttggtgtgaacgagaaggaatataagccagacattcacattctttccaatgccagttgcactaccaactgccttgctcc
ccttgccaaggttatcaacgacaggtttgggattgttgagggtctcatgaccacggtgcactccatcactgccacccaaa
agactgtcgacggtccatcaatgaaggactggagaggtggacgtgctgcttccttcaacatcattcctagcagcactgga
gctgccaaggctgttggaaaggtgctcccatctcttaatggaaaattgaccggaatgtccttccgtgtgcccactgttga
tgtttccgttgttgacctgactgtcaggctggagaagcctgcaacctatgaacagatcaaggccgctatcaaggaggagt
cagaaggcaaaat
back to top