PL, PL (gene) Pyrus x bretschneideri

Gene Overview
Name PL
Gene Symbol PL
Type gene
Organism Pyrus x bretschneideri
Synonym pectate lyase
Description NA
Comment forms right handed beta helix structure; involved in maceration and soft rotting of plant tissue
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
PLKJ547669.1-PL.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
pectate lyasePLPyrus x bretschneiderigene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KJ547669.1-PL.m1 scaffold01715:4349..6245
KJ547669.1

Sequence(s):
>KJ547669.1-PL.m11245
atgccaaaaatggcaaggccctcctcaggcccctcacttctctctctcctcctcctctctctcctcttcccaaccctcat
ttcctccaggccacttcatctccaagaccctgaattggtagtacaagaggtacaaaggaatattagcgactcagtgtcta
ggaggaacttgggctacttgtcatgcgggacgggcaaccctatcgacgactgctggcggtgcgacccgaactgggagaag
aacaggcagagcctagcagattgtgcgatagggttcggaaagaacgccataggtggaagagacgggaagatttacgtggt
cacagattccggcgacgacgaccctgtgaaccccaagccaggaaccctacgacacgccgtcatccaagaggagccattat
ggatcattttccagcgcgacatgaccatccagctgaaggaggagctgatcatgaactccttcaagacaatcgacggccgg
ggagcgtccgtacacattgccggtgggccatgcatcaccatccagttcgtgaccaacattattatccacggactgcacat
acacgattgcaagcagggtgggaacgctatggtgaggagctcccccagtcacttcgggtggaggaccgtatcggacggcg
acggcgtgtcgatcttcggtgggagccacgtgtgggtggaccattgctcgttgtccaactgcaaagatgggttggttgat
gcgatttatgggtccactgcgataacgatttcgaacaattacatgacgcaccatgataaggtgatgcttttggggcatag
cgattcgtataccaaggacaagaacatgcaaatcaccattgcgttcaatcactttggagaaggcttggtccaaagaatgc
caagatgtaggcatggatatttccatgtggtgaacaatgactacacccattgggagatgtatgccattggtgggagtgca
gaccctacaatcaatagccaagggaacagatttgctgcaccagatatcagatccagcaaagaggtgaccaaacatgagga
tgcacccgaaagtgaatggaagaattggaactggaggtcggaaggagacttgctgctcaacggtgcgttttttacggcat
caggtgccggagcttcctcaagctacgccagggcttcgagcttgggtgcgaagccatcttctctagtgggtgcgattacc
acggcttccggcgcactcagttgccggaagggctctcgttgctga
back to top