SFBB18-gamma, SFBB18-gamma (gene) Pyrus x bretschneideri

Gene Overview
Name SFBB18-gamma
Gene Symbol SFBB18-gamma
Type gene
Organism Pyrus x bretschneideri
Synonym SFBB18-gamma
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus x bretschneiderigene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBB18-gammaEU081896.1-SFBB18-gamma.m1Pyrus x bretschneiderimRNA
SFBB18-gammaEU081894.1-SFBB18-gamma.m1Pyrus x bretschneiderimRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database EU081896.1-SFBB18-gamma.m1 scaffold01086:55112..56303
EU081896.1
mRNA parsed from NCBI nr database EU081894.1-SFBB18-gamma.m1 scaffold01086:55112..56303
EU081894.1

Sequence(s):
>EU081896.1-SFBB18-gamma.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgatcgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
tgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgatggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top
>EU081894.1-SFBB18-gamma.m11191
atgtctcaggtgcgtgaaagtgaaactcttgaagataggatggtcgaaatcttgtccaggttgccacccaagtctctgat
gcgattcaaatgcatacgcaaatcttggtgcactcttatcaatagtccatgttttgtggccaaacacctcagcgattctg
tggacaacaaactctcatcctccacttgtatccttctcaactgttctcaggctcacgtttgctcggaaaagagttggaaa
caagaagtttcatggtccgtgattaatctttccattgatggtgatgagcttcattatgatattgaggacctaactattgt
accgtttctaaaggatggccctcatgaagtagagattcacggttattgcgatgggattgtttgtgtaacagtagacgaaa
atttctttttgtgcaatcctgcaacgggggaattcaggcaacttcctgattcatgccttcttctaccccttcccggggta
aaagaaaaattcggattggaaacgacacttaaaggactgggatttggttatgattgcaaagctaaagaatacaaggttgt
gcgaattatagataattatgatcgtgagtattcagaagatggagaaacatatatcgagcatattgctcttccttacactg
ctgaagtatacaccatggctgctaactcttggaaagagatcacgattgatatactaagtaaaatattatcatcatatagc
gaaccatattcttattcagtgtatttgaaggggttttgttattggttgtcatgcgatgtagaggaatacatattttcatt
tgatttagctaatgaaatatctgatatgatagaattgccttttaggggagaattcggttttaaacgtgatggtatttttc
tgtacaatgaatccctcacttattattgcagtagttatgaagagccttccacattatttgagatatgggtaatggactac
gatgatggatttaagagttcatggacaaaacacctaactgctggaccttttacagatatggagtttccattgacaccttg
gaaacgtgacgagcttcttatgattgcctccgatggaagagctgcctcttataattcttgtaccggaaatttcaagtatc
ttcatattcctgttattattaatcagaatagggttgtagattacgtgaaaagtattattctagtcaattga
back to top