COX2, HQ731509.1-COX2.m1 (mRNA) Rubus coreanus

Unique NameHQ731509.1-COX2.m1
OrganismRubus coreanus ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
COX2HQ731509.1-COX2Rubus coreanusgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
COX2COX2Rubus coreanusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HQ731509.1-COX2.m1-cds1HQ731509.1-COX2.m1-cds1Rubus coreanusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
COX2HQ731509.1-COX2.p1Rubus coreanuspolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
HQ731509 region HQ731509:2..769+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>HQ731509.1-COX2.m1 ID=HQ731509.1-COX2.m1|Name=COX2|organism=Rubus coreanus|type=mRNA|length=768bp
back to top

protein sequence of COX2

>HQ731509.1-COX2.p1 ID=HQ731509.1-COX2.p1|Name=COX2|organism=Rubus coreanus|type=polypeptide|length=255bp
back to top

mRNA from alignment at HQ731509:2..769+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HQ731509.1-COX2.m1 ID=HQ731509.1-COX2.m1|Name=COX2|organism=Rubus coreanus|type=mRNA|length=768bp|location=Sequence derived from alignment at HQ731509:2..769+ (Rubus coreanus)
atgattgttctagaatggctattcctcacaattgctccttgtgatgcagc ggaaccatggcaattaggatttcaagacgcagcaacccctatgatgcaag gaataatggacttacatcacgatatctttttcttcctcattctgattttg gttttcgtatcacggatcttggttcgcgctttatggcatttccactataa aaaaaatccaatcccgcaaaggattgttcatggaactactatcgagattc ttcggaccatatttcctagtatcatcccgatgttcattgctataccatca tttgctttgttatactcaatggacgaggtagtagtagatccagccattac tatcaaagctattggacatcaatggtatcggacttatgagtattcagact ataacagttccgatgaacagtcactcacttttgacagttatacgattcca gaagatgatctagaattgggtcaatcgcgtttattagaagtggacaatag agtggttgtaccagccaaaactcatctacgtattattgtaacacctgctg atgtacttcatagttgggctgtaccttcctcaggtgtcaaatgtgatgct gtacctggtcgtttaaatcagatctctatttcggtacaacgagaaggagt ttactatggtcagtgcagtgagatttgtggaactaatcatgcctttacgc ctatcgtcgtagaagctgttcctaggaaagattatggttctcgggtatcc aatcaattaatcccataa
back to top

Coding sequence (CDS) from alignment at HQ731509:2..769+

>HQ731509.1-COX2.m1 ID=HQ731509.1-COX2.m1|Name=COX2|organism=Rubus coreanus|type=CDS|length=768bp|location=Sequence derived from alignment at HQ731509:2..769+ (Rubus coreanus)
back to top