|
Marker Overview
Name | BPPCT006 |
Genbank ID | N/A |
Type | SSR |
Species | Prunus persica |
Germplasm | OHenry |
Source Type | Genomic DNA genomic |
Repeat Motif | (AG)19 |
PCR Condition | 94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min |
Primer 1 | BPPCT006.F primer: GCTTGTGGCATGGAAGC |
Primer 2 | BPPCT006.R primer: CCCTGTTTCTCATAGAACTCACAT |
Product Length | 117 |
Polymorphism | P_ BPPCT006 |
Publication | [view all] |
Contact | E. Dirlewanger Amy Iezzoni
|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2002 | Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138. |
2005 | Scientia Horticulturae, 103: 305?315 |
2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
2002 | Dirlewanger E, Cosson P, Tavaud M, Aranzana M, Poizat C, Zanetto A, Arus P, Laigret F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theoretical and applied genetics. 2002 July; 105(1):127-138. |
Germplasm
Stock Name | Type |
OHenry | accession |
|