BPPCT007, BPPCT007 (genetic_marker) Prunus persica

Marker Overview


Name	BPPCT007
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Germplasm	OHenry
Source Type	Genomic DNA
Repeat Motif	(AG)22(CG)2(AG)4
PCR Condition	94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1	BPPCT007.F primer: TCATTGCTCGTCATCAGC
Primer 2	BPPCT007.Forward primer: TCATTGCTCGTCATCAGC
Primer 3	BPPCT007.R primer: CAGATTTCTGAAGTTAGCGGTA
Primer 4	BPPCT007.Reverse primer: CAGATTTCTGAAGTTAGCGGTA
Product Length	149
Polymorphism	P_ BPPCT007
Publication	[view all]
Contact	E. Dirlewanger
Associated With	GWAS0001931

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold_3	supercontig	scaffold_3:2741939..2741939 .	Prunus persica Whole Genome v1.0 Assembly & Annotation	n/a
Pp03	chromosome	Pp03:3602939..3603083 .	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	GDR marker alignment to genome using primer sequences
Pd03	chromosome	Pd03:3441256..3441408 .	Prunus dulcis Lauranne Genome v1.0	GDR marker alignment to genome using primer sequences

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01

Publications


Year	Publication
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.
2005	Scientia Horticulturae, 103: 305?315

Germplasm


Stock Name	Type
OHenry	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Almond-NL-F1-2010	G3	N/A	25.18	BPPCT007	View
2	Almond-VB-F1	G3	N/A	0	BPPCT007	View
3	Peach-DG-F1-2009	G3	N/A	11.4	BPPCT007	View
4	Apricot-PA-F1	G5	N/A	0	BPPCT007	View
5	Peach-CF-F2-2014	3	N/A	7.1	BPPCT007	View
6	Prunus-TE-F2	G3	N/A	11.2	BPPCT007	View
7	Peach-VV-F2	G3	N/A	4.3	BPPCT007	View
8	Peach-LAxFG-F2	LG3	N/A	0	BPPCT007	View
9	Prunus-TE-F2-2015	3	N/A	5.3	BPPCT007	View
10	Sweet Cherry-WL-F1-2015	LG3	N/A	9.5	BPPCT007	View
11	Peach-HU-F2	G3	N/A	11.5	BPPCT007	View
12	Peach-DvsS-BC2	LG3	N/A	8	BPPCT007	View
13	Prunus-TE-BC1-T1E	G3_T1E	N/A	6.5	BPPCT007	View
14	Prunus-TxE-peachV2.0	LG3	N/A	11.2	BPPCT007	View
15	Peach-CF-F2	G3	N/A	4	BPPCT007	View
16	Chokecherry-RCxSC-F1-2014	SC VII	N/A	0	BPPCT007-4	View
17	Chokecherry-RCxSC-F1-2017	Cho-7	N/A	97.54	BPPCT007-4	View
18	Chokecherry-RCxSC-F1-2014	SC VII	N/A	10.9	BPPCT007-2	View
19	Chokecherry-RCxSC-F1-2017	Cho-7	N/A	105.15	BPPCT007-2	View
20	Chokecherry-RCxSC-F1-2014	SC VII	N/A	18.9	BPPCT007-8	View
21	Chokecherry-RCxSC-F1-2017	Cho-7	N/A	101.2	BPPCT007-8	View
22	Chokecherry-RCxSC-F1-2014	SC VII	N/A	30.9	BPPCT007-1	View
23	Chokecherry-RCxSC-F1-2017	Cho-7	N/A	93.88	BPPCT007-1	View
24	Peach_Consensus_map_2018	3	N/A	9.84	BPPCT007	View

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
28:fruit fresh weight	fruit fresh weight