BPPCT017, BPPCT017 (genetic_marker) Prunus persica

Marker Overview


Name	BPPCT017
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Germplasm	OHenry
Source Type	Genomic DNA genomic
Repeat Motif	(GA)28
PCR Condition	94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1	BPPCT017.F primer: TTAAGAGTTTGTGATGGGAACC
Primer 2	BPPCT017.Forward primer: TTAAGAGTTTGTGATGGGAACC
Primer 3	BPPCT017.R primer: AAGCATAATTTAGCATAACCAAGC
Primer 4	BPPCT017.Reverse primer: AAGCATAATTTAGCATAACCAAGC
Product Length	174
Polymorphism	P_ BPPCT017
Publication	[view all]
Contact	E. Dirlewanger
Associated With	GWAS0001951

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold_5	supercontig	scaffold_5:11174442..11174442 .	Prunus persica Whole Genome v1.0 Assembly & Annotation	n/a
Pp05	chromosome	Pp05:11172680..11172841 .	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	GDR marker alignment to genome using primer sequences
PAV05_REGINA	chromosome	PAV05_REGINA:12519151..12519346 .	Prunus avium Regina Genome v1.0 Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr_5	chromosome	chr_5:26441621..26441816 .	Prunus avium Tieton Genome v2.0 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01

Publications


Year	Publication
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.
2005	Scientia Horticulturae, 103: 305?315
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana M, Poizat C, Zanetto A, Arus P, Laigret F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theoretical and applied genetics. 2002 July; 105(1):127-138.

Germplasm


Stock Name	Type
OHenry	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-JF-F2	G5	N/A	52	BPPCT017	View
2	Almond-NL-F1-2010	G5	N/A	26.89	BPPCT017	View
3	Peach-DG-F1-2009	G5	N/A	52.1	BPPCT017	View
4	Peach-GN-F2	G5	N/A	43	BPPCT017	View
5	Peach-ScB-F2-2007	G5	N/A	34.47	BPPCT017	View
6	Peach-AJ-F2-2005	G5	N/A	35.8	BPPCT017	View
7	Peach-AJ-F2	G5	N/A	35.8	BPPCT017	View
8	Peach-PF-BC1-2005	G5	N/A	20	BPPCT017	View
9	Almond-RD-F1	G5	N/A	19.9	BPPCT017	View
10	Prunus-TE-F2	G5	N/A	20.1	BPPCT017	View
11	Flowering Cherry-CYxE750-F1-CY	5	N/A	27.1	BPPCT017	View
12	Flowering Cherry-CYxE750-F1-E750	5	N/A	32.7	BPPCT017	View
13	Peach-LAxFG-F2	LG5	N/A	24.2	BPPCT017	View
14	Peach-PIxSL-F2	LG5	N/A	24.5	BPPCT017	View
15	Prunus-TE-F2-2015	5	N/A	21.1	BPPCT017	View
16	Prunus-TE-BC1-T1E	G5_T1E	N/A	15.3	BPPCT017	View
17	Prunus-TxE-peachV2.0	LG5	N/A	20.1	BPPCT017	View
18	Chokecherry-RCxSC-F1-2014	SC X	N/A	0	BPPCT017-1	View
19	Chokecherry-RCxSC-F1-2017	Cho-10	N/A	80.76	BPPCT017-1	View
20	Sweet Cherry-PAxPN-94	G5	N/A	20.6	nBPPCT017	View
21	Sweet Cherry-47	G5	N/A	20.8	nBPPCT017	View
22	Peach_Consensus_map_2018	5	N/A	18.84	BPPCT017	View

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
28:first ripening date	fruit ripening date first