EPDCU2584 (genetic_marker) Prunus dulcis | GDR

Marker Overview

Marker Overview


Name	EPDCU2584
Genbank ID	N/A
Type	SSR
Species	Prunus dulcis
PCR Condition	1 min at 94C; 35 cycles of 15 s at 94C, 15 s at 57C and 30 s at 72C, followed by a 5 min extension at 72C
Primer 1	EPDCU2584.forward primer: TTCAGCTCATCTAGTTTCATCACC
Primer 2	EPDCU2584.reverse primer: CACGGTTCGAACAACATCTG
Publication	[view all]
Contact	P. Martinez-gomez

Contact

Name

Details

P. Martinez-gomez

First name:	Pedro
Last name:	Martinez-Gomez
Institution:	Plant Breeding Department. CEBAS-CSIC
Address:	Campus Universitario de Espinardo. P.O. Box 164, E-30100. Espinardo. Murcia. Spain
Email:	pmartinez@cebas.csic.es
Phone:	968-396362

Publications


Year	Publication
2007	Sanchez-Perez R, Howad W, Dicenta F, Arus P, Martinez-Gomez P. Mapping major genes and quantitative trait loci controlling agronomic traits in almond. Plant Breeding. 2007; 126(3):310-318.
2010	Rodríguez-Kessler M, Delgado-Sánchez P, Rodríguez-Kessler GT, Moriguchi T, Jiménez-Bremont JF. Genomic organization of plant aminopropyl transferases. Plant physiology and biochemistry : PPB / Société française de physiologie végétale. 2010 Jul; 48(7):574-90.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Almond-NL-F1-2010	G5	N/A	29.58	EPDCU2584	View

Alignments

Feature Name	Type	Location	Analysis
Pp05	chromosome	Pp05:12306537..12306670.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV05_REGINA	chromosome	PAV05_REGINA:13805824..13805957.	Prunus avium Regina Genome v1.0 Assembly & Annotation
chr_5	chromosome	chr_5:27719000..27719133.	Prunus avium Tieton Genome v2.0 Assembly & Annotation
Pd05	chromosome	Pd05:11152014..11152140.	Prunus dulcis Lauranne Genome v1.0