|
|
Marker Overview
| Name | EPPCU6377 |
|---|
| Genbank ID | BU046377 |
|---|
| Type | EST-SSR |
|---|
| Species | Prunus persica |
|---|
| Source Type | EST |
|---|
| PCR Condition | 94 C 5 min, 94 C 1 min, 55 C 1 min, 72 C 2 min. 35 cycles, 72 C 7min |
|---|
| Primer 1 | EPPCU6377.F primer: CTTAATAAACGCCTTCGACT |
|---|
| Primer 2 | EPPCU6377.R primer: ATACCAGCCTGACCGATGTG |
|---|
| Product Length | 123 |
|---|
| Publication | [view all] |
|---|
| Contact | P. Arus
|
|---|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2005 | Howad W, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G, Monforte AJ, Georgi L, Abbott AG, Arús P. Mapping with a few plants: using selective mapping for microsatellite saturation of the Prunus reference map. 2005 Nov; 171(3):1305-1309. |
| 2016 | José Luis Zeballos, Walid Abidi , Rosa Giménez, Antonio J. Monforte, María Ángeles Moreno, Yolanda Gogorcena. Mapping QTLs associated with fruit quality traits in peach [Prunus persica (L.) Batsch] using SNP maps. Tree Genetics & Genomes June 2016, 12:37 |
|
