CH05g03, CH05g03 (genetic_marker) Malus x domestica

Marker Overview


Name	CH05g03
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	CH05g03.primer 1: GCTTTGAATGGATACAGGAACC
Primer 2	CH05g03.primer 2: CCTGTCTCATGGCATTGTTG
Product Length	135-192
Polymorphism	P_ CH05g03
Publication	[view all]
Contact	C. Gessler Andreas Peil Miyuki Kunihisa

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Andreas Peil

First name:	Andreas
Last name:	Peil
Title:	Researcher
Institution:	Institute for Breeding Research on Fruit
Address:	Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:	Dresden, Germany
Email:	andreas.peil@jki.bund.de

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr17	chromosome	Chr17:5563689..5563852 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr17A	chromosome	chr17A:5121382..5121539 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2004	Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2006	Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014	Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-C16xC17-F1-2012	17	N/A	27.97	CH05g03	View
2	Pear-BH-F1	Ho17	N/A	12.1	CH05g03	View
3	Apple-FD-F1-2006	D17	N/A	21.2	CH05g03	View
4	Apple-FD-F1-2006	F17	N/A	13.2	CH05g03	View
5	Apple-IM-F1-Idared	Ida LG 17	N/A	15	CH05g03	View
6	Apple-IM-F1-Mr5	Mr5 LG 17	N/A	32.5	CH05g03	View
7	Apple-OA-F1-Orin	OR17	N/A	16.3	CH05g03	View
8	Apple-OA-F1-Akane	AK17-1	N/A	12	CH05g03	View
9	Pear-AN-F1	LG17	N/A	7.3	CH05g03	View
10	Apple-X5210X8402-F1-Consensus	LG17	N/A	17.3	CH05g03	View
11	Apple-X5210X8402-F1-X5210	LG17	N/A	4.1	CH05g03	View
12	Apple-X5210X8402-F1-X8402	LG17	N/A	10.8	CH05g03	View
13	Apple-JM7xS63-F1	J17	N/A	8.5	CH05g03	View
14	Pear-BD-F1-2014-genetic	LG17	N/A	95.9	CH05g03	View
15	Pear-La_France-F1-2007	La17	N/A	20.6	CH05g03	View
16	Apple-FD-Discovery-F1-2003	D17	N/A	22.3	CH05g03	View
17	Pear-BD-F1-2015	LG17	N/A	87.3	CH05g03	View
18	Pear-Bayuehong-F1-2015	LG17	N/A	86.65	CH05g03	View
19	Pear-Dangshansuli-F1-2015	LG17	N/A	87.4	CH05g03	View
20	Pear-integrated_consensus_map-IPCG-2017	LG17	N/A	89.76	CH05g03	View
21	Pear-Rcf-F1-female	LG17	N/A	79.69	CH05g03	View
22	Pear-RM-F1-Integrated	LG17	N/A	127.57	CH05g03	View
23	Apple-JM7xS63-F1	J17	N/A	8.5	CH05g03	View
24	Apple-JM7xS63-F1	S17	N/A	22.8	CH05g03	View