CH05d03, CH05d03 (genetic_marker) Malus x domestica

Marker Overview


Name	CH05d03
Genbank ID	N/A
Type	SSR
Species	Malus x domestica
Repeat Motif	GA
PCR Condition	annealing temp 60 degree
Primer 1	CH05d03.primer 1: TACCTGAAAGAGGAAGCCCT
Primer 2	CH05d03.primer 2: TCATTCCTTCTCACATCCACT
Product Length	152-187
Polymorphism	P_ CH05d03
Publication	[view all]
Contact	C. Gessler Miyuki Kunihisa

Contact

Name

Details

C. Gessler

First name:	Cesare
Last name:	Gessler
Institution:	ETH Zurich
Address:	ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:	Switzerland
Email:	cesare.gessler@agrl.ethz.ch
Phone:	+41 44 632 38 71
Fax:	+41 (0) 632 11 08
Last update:	May 2002

Miyuki Kunihisa

First name:	Miyuki
Last name:	Kunihisa
Institution:	NARO Institute of Fruit Tree Science
Address:	2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:	Japan
Email:	miyuky@affrc.go.jp
Phone:	81-29-838-6437
Keywords:	fruit drop

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr14	chromosome	Chr14:26815713..26815884 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr14A	chromosome	chr14A:26041782..26041951 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2006	Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2002	Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2012	Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014	Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-FD-F1-2006	F14	N/A	32.3	CH05d03	View
2	Apple-FD-F1-2006	D14a	N/A	22.7	CH05d03	View
3	Apple-PF-F1-2012	ch14	N/A	44	CH05d03	View
4	Apple-MM-F1	14	N/A	34.6	CH05d03	View
5	Apple-OA-F1-Orin	OR14	N/A	47.3	CH05d03	View
6	Apple-OA-F1-Akane	AK14	N/A	16.3	CH05d03	View
7	Apple-M432-2012	LG14	N/A	18.4	CH05d03	View
8	Apple-RGTxGD-F1-2015	RGT_14	N/A	41.3	CH05d03	View
9	Apple-RGTxGD-F1-2015	GD_14	N/A	60.62	CH05d03	View
10	Apple-JGxWSH-F1	LG14	N/A	0	CH05d03	View
11	Apple-WSH-F1	LG14	N/A	0	CH05d03	View
12	Pear-BD-F1-2014-genetic	LG14	N/A	133.9	CH05d03	View
13	Pear-Bartlett-F1-2007	Ba14	N/A	45.3	CH05d03	View
14	Pear-La_France-F1-2007	La14	N/A	46.3	CH05d03	View
15	Apple-FD-Discovery-F1-2003	D14	N/A	22.1	CH05d03	View
16	Pear-Ba-F1-2013	Ba14	N/A	45	CH05d03	View
17	Pear-BD-F1-2015	LG14	N/A	69	CH05d03	View
18	Pear-Bayuehong-F1-2015	LG14	N/A	69.48	CH05d03	View
19	Pear-Dangshansuli-F1-2015	LG14	N/A	68.88	CH05d03	View
20	Pear-integrated_consensus_map-IPCG-2017	LG14	N/A	176.63	CH05d03	View