CH05e05, CH05e05 (genetic_marker) Malus x domestica

Marker Overview
NameCH05e05
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05e05.primer 1: TCCTAGCGATAGCTTGTGAGAG
Primer 2CH05e05.primer 2: GAAACCACCAAACCGTTACAAT
Product Length138-160
PolymorphismP_ CH05e05
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Publications
YearPublication
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map14N/A29.4CH05e05View
2Apple-FD-F1-2006F14N/A25.8CH05e05View
3Apple-FD-F1-2006D14aN/A14.1CH05e05View
4Apple-IM-F1-IdaredIda LG 14N/A37.7CH05e05View
5Apple-OA-F1-OrinOR14N/A36.7CH05e05View
6Apple-X3259X3263-F114N/A36.77CH05e05View