|
|
Marker Overview
| Name | BPPCT013 |
|---|
| Genbank ID | AF374940 |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Germplasm | OHenry |
|---|
| Source Type | Genomic DNA |
|---|
| Repeat Motif | (AG)28 |
|---|
| PCR Condition | 94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min |
|---|
| Primer 1 | BPPCT013.F primer: ACCCACAAATCAAGCATATCC |
|---|
| Primer 2 | BPPCT013.R primer: AGCTTCAGCCACCAAGC |
|---|
| Product Length | 183 |
|---|
| Polymorphism | P_ BPPCT013 |
|---|
| Publication | [view all] |
|---|
| Contact | E. Dirlewanger
Amy Iezzoni
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2002 | Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138. |
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
Germplasm
| Stock Name | Type |
|---|
| OHenry | accession |
|
