BPPCT023, BPPCT023 (genetic_marker) Prunus persica

Marker Overview


Name	BPPCT023
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Germplasm	OHenry
Source Type	Genomic DNA
Repeat Motif	(CT)21
PCR Condition	94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1	BPPCT023.F primer: TGCAGCTCATTACCTTTTGC
Primer 2	BPPCT023.R primer: AGATGTGCTCGTAGTTCGGAC
Product Length	224
Publication	[view all]
Contact	E. Dirlewanger
Associated With	GWAS0001923

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01

Publications


Year	Publication
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.

Germplasm


Stock Name	Type
OHenry	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-JF-F2	G4	N/A	52.1	BPPCT023	View
2	Peach-AJ-F2-2005	G4	N/A	53.9	BPPCT023	View
3	Peach-ScB-F2-2007	G4	N/A	57.32	BPPCT023	View
4	Prunus-TE-F2	G4	N/A	45.4	BPPCT023	View
5	Peach-PF-BC1-2005	G4	N/A	47.4	BPPCT023	View
6	Peach-AJ-F2	G4	N/A	53.9	BPPCT023	View
7	Peach-DG-F1-2009	G4	N/A	66.7	BPPCT023	View
8	Prunus-TE-F2-2015	4	N/A	43	BPPCT023	View
9	Peach-LAxFG-F2	LG4	N/A	47	BPPCT023	View
10	Peach-PIxSL-F2	LG4	N/A	46.8	BPPCT023	View
11	Prunus-TxE-peachV2.0	LG4	N/A	45.4	BPPCT023	View
12	Peach-CA-BC1-2017	LG4	N/A	49.4	BPPCT023	View
13	Peach_Consensus_map_2018	4	N/A	53.8	BPPCT023	View

Alignments

Feature Name	Type	Location	Analysis
scaffold_4	supercontig	scaffold_4:14731772..14731772.	Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04	chromosome	Pp04:14742315..14742546.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
28:stone adherence	fruit flesh adhesion