BPPCT028, BPPCT028 (genetic_marker) Prunus persica

Marker Overview


Name	BPPCT028
Genbank ID	AF374944
Type	SSR
Species	Prunus persica
Germplasm	OHenry
Source Type	Genomic DNA genomic
Repeat Motif	(TC)15
PCR Condition	94 C 1 min, 94 C 45 sec, 57 C 45 sec, 72 C 2 min. 35 cycles, 72 C 4min
Primer 1	BPPCT028.F primer: TCAAGTTAGCTGAGGATCGC
Primer 2	BPPCT028.Forward primer: TCAAGTTAGCTGAGGATCGC
Primer 3	BPPCT028.R primer: GAGCTTGCCTATGAGAAGACC
Primer 4	BPPCT028.Reverse primer: GAGCTTGCCTATGAGAAGACC
Product Length	164
Polymorphism	P_ BPPCT028
Publication	[view all]
Contact	E. Dirlewanger
Associated With	GWAS0001924

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold_1	supercontig	scaffold_1:45685116..45685797 .	Prunus persica Whole Genome v1.0 Assembly & Annotation	n/a
Pp01	chromosome	Pp01:44130041..44130722 -	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	n/a
Pd01	chromosome	Pd01:39957930..39958103 .	Prunus dulcis Lauranne Genome v1.0	GDR marker alignment to genome using primer sequences

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01
Alignment of genetic markers to Prunus persics v2.0	2019-04-11

Publications


Year	Publication
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana M, Poizat C, Zanetto A, Arus P, Laigret F. Development of microsatellite markers in peach [Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry (Prunus avium L.). Theoretical and applied genetics. 2002 July; 105(1):127-138.
2012	Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.

Germplasm


Stock Name	Type
OHenry	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-JF-F2	G1	N/A	124.1	BPPCT028	View
2	Prunus-TE-F2	G1	N/A	77.4	BPPCT028	View
3	Peach-DG-F1-2009	G1	N/A	138	BPPCT028	View
4	Peach-AJ-F2-2005	G1	N/A	71.1	BPPCT028	View
5	Peach-AJ-F2	G1	N/A	71.1	BPPCT028	View
6	Peach-CF-F2-2014	1	N/A	90.03	BPPCT028	View
7	Flowering Cherry-CYxE750-F1-CY	1	N/A	75.9	BPPCT028	View
8	Flowering Cherry-CYxE750-F1-E750	1	N/A	2.3	BPPCT028	View
9	Apple-MM-F1	15	N/A	107.4	BPPCT028	View
10	Apple-M432-2012	LG15	N/A	111.1	BPPCT028	View
11	Peach-LAxFG-F2	LG1	N/A	35.3	BPPCT028	View
12	Prunus-TE-F2-2015	1	N/A	78.6	BPPCT028	View
13	Sweet Cherry-WL-F1-2015	LG1	N/A	158.5	BPPCT028	View
14	Peach-DvsS-BC2	LG1	N/A	80	BPPCT028	View
15	Prunus-TxE-peachV2.0	LG1	N/A	77.4	BPPCT028	View
16	Sweet Cherry-C-303xBenikirari-F1	Pa1	N/A	116.84	BPPCT028	View
17	Sweet Cherry-PAV_r1.0_consensus_map-F1	Pa1	N/A	146.73	BPPCT028	View
18	Peach-CF-F2	G1	N/A	88.9	BPPCT028	View
19	Chokecherry-RCxSC-F1-2014	RC XVa	N/A	61.1	BPPCT028-3	View
20	Chokecherry-RCxSC-F1-2014	SC XIIb	N/A	45.6	BPPCT028-1	View
21	Chokecherry-RCxSC-F1-2017	Cho-8	N/A	133.95	BPPCT028-1	View
22	Strawberry-232x1392-F1-2015	LGV-3	N/A	45.32	BPPCT028-157	View
23	Sweet Cherry-PAxPN-94	G1	N/A	124.1	nBPPCT028	View
24	Sweet Cherry-47	G1	N/A	122	nBPPCT028	View
25	Peach_Consensus_map_2018	1	N/A	89.01	BPPCT028	View

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
MAIN:000200517	fruit texture
28:stone adherence	fruit flesh adhesion