|
Marker Overview
Name | CFVCT005A |
Genbank ID | N/A |
Type | SSR |
Species | Fragaria vesca |
Germplasm | Reine des Vallees |
Source Type | genomic clone |
PCR Condition | Final reaction volume of 12.5ul comprising 1.5ul template DNA, 1x PCR buffer, 1.5mM Mg2+, 200 M dNTPs, 0.2uM each primer and 0.25U Taq polymerase. PCR cycles: initial denaturation step of 94oC (2min), then 10 cycles of 94oC (30s), 55-50oC annealing temperature decreasing by 0.5oC per cycle (45s) and 72oC (1min), followed by 25 cycles of 94oC (30s), 50oC (45s) and 72oC (1min), and a final elongation step of 72oC (5min) |
Primer 1 | CFVCT005R: CTTCTCCTCGCCTGTGAAAT |
Publication | [view all] |
Contact | D. Sargent
|
Publications
Year | Publication |
2006 | Sargent DJ, Clarke J, Simpson DW, Tobutt KR, Arús P, Monfort A, Vilanova S, Denoyes-Rothan B, Rousseau M, Folta KM, Bassil NV, Battey NH. An enhanced microsatellite map of diploid Fragaria. Theoretical and Applied Genetics. 2006 May; 112(7):1349-1359. |
|