CPPCT015, CPPCT015 (genetic_marker) Prunus persica

Marker Overview


Name	CPPCT015
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Source Type	Genomic DNA
Repeat Motif	(CT)31
PCR Condition	94 C 1 min, 94 C 30 sec, 50 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1	CPPCT015.Forward Primer: TGGAGTGCCAATACTATTTACATATGCATGGTTATGGT
Primer 2	CPPCT015.primer 1: TGGAGTGCCAATACTATTTACATATGCATGGTTATGGT
Product Length	200
Publication	[view all]
Contact	E. Dirlewanger Maria Badenes
Associated With	GWAS0001946

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01
Alignment of genetic markers to Prunus persics v2.0	2019-04-11

Publications


Year	Publication
2002	Plant breeding = Zeitschrift fr Pflanzenzchtung. Plant breed. Feb 2002. v. 121 (1) p. 87-92. ISSN 0179-9541; PLABED
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-AJ-F2-2005	G6	N/A	46.7	CPPCT015	View
2	Peach-AJ-F2	G6	N/A	46.7	CPPCT015	View
3	Peach-CF-F2-2014	6	N/A	14.48	CPPCT015	View
4	Prunus-TE-F2	G6	N/A	35.8	CPPCT015	View
5	Prunus-TE-BC1-E	G4_E	N/A	56.6	CPPCT015	View
6	Prunus-TxE-peachV2.0	LG6	N/A	35.8	CPPCT015	View
7	Peach-CF-F2	G6	N/A	10.5	CPPCT015	View

Alignments

Feature Name	Type	Location	Analysis
scaffold_6	supercontig	scaffold_6:16352480..16352831.	Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp06	chromosome	Pp06:18218748..18219099+	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
MAIN:000192249	chilling requirement
28:full bloom date	flower date 100%