CPPCT026 (genetic_marker) Prunus persica

Marker Overview


Name	CPPCT026
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Source Type	Genomic DNA genomic
Repeat Motif	(CT)22
PCR Condition	94 C 1 min, 94 C 30 sec, 55 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1	CPPCT026.Forward Primer: AGACGCAGCACCCAAACTACCATTACATCACCGCCAACAA
Primer 2	CPPCT026.primer 1: AGACGCAGCACCCAAACTACCATTACATCACCGCCAACAA
Product Length	180
Publication	[view all]
Contact	E. Dirlewanger Maria Badenes
Associated With	GWAS0001927

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2002	Plant breeding = Zeitschrift fr Pflanzenzchtung. Plant breed. Feb 2002. v. 121 (1) p. 87-92. ISSN 0179-9541; PLABED
2005	Yamamoto T, Yamaguchi M, Hayashi T. An Integrated Genetic Linkage Map of Peach by SSR, STS, AFLP and RAPD. Journal of the Japanese Society for Horticultural Science. 2005; 74(3):204-213.
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-AJ-F2-2005	G1	N/A	46	CPPCT026	View
2	Peach-AJ-F2	G1	N/A	46	CPPCT026	View
3	Peach-CF-F2-2014	1	N/A	60.84	CPPCT026	View
4	Prunus-TE-F2	G1	N/A	33.9	CPPCT026	View
5	Flowering Cherry-CYxE750-F1-CY	1	N/A	46.7	CPPCT026	View
6	Peach-LAxFG-F2	LG1	N/A	0	CPPCT026	View
7	Peach-PIxSL-F2	LG1	N/A	0	CPPCT026	View
8	Apricot-LL-F2-Lito-2011	LG1	N/A	58.8	CPPCT026	View
9	Prunus-TE-F2-2015	1	N/A	45	CPPCT026	View
10	Peach-DvsS-BC2	LG1	N/A	60	CPPCT026	View
11	Peach-BN-F1	LG1_Bb	N/A	37.7	CPPCT026	View
12	Prunus-TE-BC1-T1E	G1_T1E	N/A	32.1	CPPCT026	View
13	Peach-Nectaross-F1	G1	N/A	30.6	CPPCT026	View
14	Peach-CF-F2	G1	N/A	57.8	CPPCT026	View
15	Apricot-LL-F2	G1	N/A	69	CPPCT26	View
16	Apricot-LB-F1	B1	N/A	74.85	CPPCT26	View
17	Apricot-LB-F1	L1	N/A	44.29	CPPCT26	View
18	Apricot-integrated-Goldrich-2011	LG1	N/A	52.6	CPPCT26	View
19	Chokecherry-RCxSC-F1-2014	RC XVb	N/A	19.6	CPPCT26-3	View
20	Chokecherry-RCxSC-F1-2017	Cho-15	N/A	64.56	CPPCT26-3	View
21	Chokecherry-RCxSC-F1-2014	RC XVb	N/A	29.3	CPPCT26-1	View
22	Chokecherry-RCxSC-F1-2017	Cho-15	N/A	68.7	CPPCT26-1	View
23	Sweet Cherry-PAxPN-94	G1	N/A	88.6	nCPPCT026	View
24	Sweet Cherry-47	G1	N/A	82.9	nCPPCT026	View
25	Peach_Consensus_map_2018	1	N/A	66.14	CPPCT026	View

Annotated Terms

The following terms have been associated with this genetic_marker:

Vocabulary: **Rosaceae Trait Ontology**
Term	Definition
MAIN:000192293	fruit firmness