CPPCT034, CPPCT034 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	CPPCT034
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Source Type	Genomic DNA
Repeat Motif	(CT)14
PCR Condition	94 C 1 min, 94 C 30 sec, 60 C 30 sec, 72 C 1 min. 34 cycles, 72 C 5min
Primer 1	CPPCT034.Forward Primer: TCGGTTTTTAAAATTCCAAAAGTTACCCTTATTTGCACCCAACA
Primer 2	CPPCT034.primer 1: TCGGTTTTTAAAATTCCAAAAGTTACCCTTATTTGCACCCAACA
Product Length	193
Publication	[view all]
Contact	E. Dirlewanger Maria Badenes

Contact

Name

Details

E. Dirlewanger

First name:	Elisabeth
Last name:	Dirlewanger
Institution:	INRA
Address:	Unite de Recherche sur les Especes Fruitieres et la Vigne, Centre de Bordeaux, BP 81, 33883 Villenave d Ornon cedex, France
Country:	France
Email:	dirlewan@bordeaux.inra.fr

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold_1	supercontig	scaffold_1:30370800..30371156 .	Prunus persica Whole Genome v1.0 Assembly & Annotation	n/a
Pp01	chromosome	Pp01:31344747..31345103 +	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	n/a

Analyses

This genetic_marker is derived from or has results from the following analyses


Analysis Name	Date Performed
GDR Markers Database	2004-01-01
Alignment of genetic markers to Prunus persics v2.0	2019-04-11

Publications


Year	Publication
2002	Plant breeding = Zeitschrift fr Pflanzenzchtung. Plant breed. Feb 2002. v. 121 (1) p. 87-92. ISSN 0179-9541; PLABED
2002	Dirlewanger E, Cosson P, Tavaud M, Aranzana J, Poizat C, Zanetto A, Arús P, Laigret F. Development of microsatellite markers in peach [ Prunus persica (L.) Batsch] and their use in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Jul; 105(1):127-138.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Almond-NL-F1-2010	G1	N/A	50.64	CPPCT034	View
2	Prunus-TE-F2	G1	N/A	40.5	CPPCT034	View
3	Apricot-LL-F2-Lito-2011	LG1	N/A	53.9	CPPCT034	View
4	Prunus-TE-BC1-T1E	G8_T1E	N/A	7.8	CPPCT034	View
5	Prunus-TE-BC1-E	G8_E	N/A	10	CPPCT034	View
6	Prunus-TxE-peachV2.0	LG1	N/A	40.5	CPPCT034	View
7	Apricot-LB-F1	B1	N/A	66.97	CPPCT34	View
8	Apricot-LB-F1	L1	N/A	37.39	CPPCT34	View
9	Apricot-integrated-Goldrich-2011	LG1	N/A	47.5	CPPCT34	View
10	Sweet Cherry-PAxPN-94	G1	N/A	79.6	nCPPCT034	View
11	Sweet Cherry-47	G1	N/A	75.2	nCPPCT034	View