|
Marker Overview
Name | EPDCU2584 |
Genbank ID | N/A |
Type | SSR |
Species | Prunus dulcis |
PCR Condition | 1 min at 94C; 35 cycles of 15 s at 94C, 15 s at 57C and 30 s at 72C, followed by a 5 min extension at 72C |
Primer 1 | EPDCU2584.forward primer: TTCAGCTCATCTAGTTTCATCACC |
Primer 2 | EPDCU2584.reverse primer: CACGGTTCGAACAACATCTG |
Publication | [view all] |
Contact | P. Martinez-gomez
|
Alignments
The following features are aligned
|