|
|
Marker Overview
| Name | EPDCU3489 |
|---|
| Genbank ID | BU573489 |
|---|
| Type | SSR |
|---|
| Species | Prunus dulcis |
|---|
| PCR Condition | 94 C 2 min, 94 C 25 sec, 57 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5 min |
|---|
| Primer 1 | EPDCU3489.F primer: AAATCAGCTCCCATCACTCC |
|---|
| Primer 2 | EPDCU3489.R primer: AGCTGAGTGGAACCAGAGGA |
|---|
| Product Length | 169 |
|---|
| Publication | [view all] |
|---|
| Contact | W. Howad
Ignazio Verde
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2010 | Rodríguez-Kessler M, Delgado-Sánchez P, Rodríguez-Kessler GT, Moriguchi T, Jiménez-Bremont JF. Genomic organization of plant aminopropyl transferases. Plant physiology and biochemistry : PPB / Société française de physiologie végétale. 2010 Jul; 48(7):574-90. |
| 2017 | Verde I, Jenkins J, Dondini L, Micali S, Pagliarani G, Vendramin E, Paris R, Aramini V, Gazza L, Rossini L, Bassi D, Troggio M, Shu S, Grimwood J, Tartarini S, Dettori MT, Schmutz J. The Peach v2.0 release: high-resolution linkage mapping and deep resequencing improve chromosome-scale assembly and contiguity. BMC genomics. 2017 Mar 11; 18(1):225. |
| 2010 | Mnejja M, Garcia-Mas J, Audergon J, Arús P. Prunus microsatellite marker transferability across rosaceous crops. Tree Genetics & Genomes. 2010. 6(5): 689-700 |
|
