|
|
Marker Overview
| Name | EPDCU4658 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Prunus dulcis |
|---|
| PCR Condition | 1 min at 94C; 35 cycles of 15 s at 94C, 15 s at 57C and 30 s at 72C, followed by a 5 min extension at 72C |
|---|
| Primer 1 | EPDCU4658.forward primer: GGGCGTGAAGGTGTTACTGT |
|---|
| Primer 2 | EPDCU4658.reverse primer: GGTGACACAGAAGAGAGCAGAA |
|---|
| Publication | [view all] |
|---|
| Contact | P. Martinez-gomez
|
|---|
Alignments
The following features are aligned
|
