|
|
Marker Overview
| Name | Fvi6b |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Fragaria virginiana |
|---|
| Source Type | genomic clone |
|---|
| Repeat Motif | GA
17mer |
|---|
| PCR Condition | Final reaction volume of 12.5ul comprising 1.5ul template DNA, 1x PCR buffer, 1.5mM Mg2+, 200 M dNTPs, 0.2uM each primer and 0.25U Taq polymerase. PCR cycles: initial denaturation step of 94oC (2min), then 10 cycles of 94oC (30s), 55-50oC annealing temperature decreasing by 0.5oC per cycle (45s) and 72oC (1min), followed by 25 cycles of 94oC (30s), 50oC (45s) and 72oC (1min), and a final elongation step of 72oC (5min) |
|---|
| Primer 1 | Fvi6B.Forward: tcctgattcaaccacaagat |
|---|
| Primer 2 | Fvi6B.Reverse (no gttt): gtaacactcattgcttcaggta |
|---|
| Primer 3 | Fvi6bR: GTAACACTCATTGCTTCAGGTA |
|---|
| Publication | [view all] |
|---|
| Contact | D. Sargent
Eric van de Weg
|
|---|
|
