|
|
Marker Overview
| Name | MA019a |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Prunus persica |
|---|
| Germplasm | Akatsuki |
|---|
| Source Type | genomic DNA |
|---|
| Repeat Motif | GA |
|---|
| Primer 1 | MA019a.F primer: AAATGGGCTGACTCTAAGAC |
|---|
| Primer 2 | MA019a.R primer: AGAACCAACGAGGCAATCAC |
|---|
| Product Length | 108 |
|---|
| Publication | [view all] |
|---|
| Contact | T. Yamamoto
|
|---|
Alignments
The following features are aligned
Analyses
This genetic_marker is derived from or has results from the following analyses
|
