PacB35 (genetic_marker) Prunus armeniaca | GDR

Marker Overview

Marker Overview


Name	PacB35
Genbank ID	N/A
Type	SSR
Species	Prunus armeniaca
Germplasm	Stark Early Orange
Source Type	cDNA
Repeat Motif	(CA)14(GA)11
PCR Condition	2 mM of MgCl2, 0.1 mM of each dNTP, 0.2 mcM of each primer, 1? Buffer and 0.5 units of Taq polymerase (Sigma)in 25 mcl final volume. Thermocycling conditions were 30 s at 94 C, followed by 30 cycles of (94 ?C for 30 s, 57.5 C for 30 s and 72 C for 30 s) and an extension step at 72 C for 7 min.
Primer 1	PacB35.forward primer: ATTGCGATTTCGGTCTGTT
Primer 2	PacB35.reverse primer: CCATCCCAAATTGCTTACTT
Product Length	207/209
Polymorphism	P_ PacB35
Publication	[view all]

Publications


Year	Publication
2003	Decroocq V, Favé MG, Hagen L, Bordenave L, Decroocq S. Development and transferability of apricot and grape EST microsatellite markers across taxa. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Mar; 106(5):912-22.

Germplasm


Stock Name	Type
Stark Early Orange	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chokecherry-RCxSC-F1-2014	SC I	N/A	0	PacB35-1	View
2	Chokecherry-RCxSC-F1-2017	Cho-1	N/A	47.01	PacB35-1	View