PacC25 (genetic_marker) Prunus armeniaca

Marker Overview
NamePacC25
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
GermplasmStark Early Orange
Source TypecDNA
Repeat Motif(CA)15
PCR Condition2 mM of MgCl2, 0.1 mM of each dNTP, 0.2 mcM of each primer, 1? Buffer and 0.5 units of Taq polymerase (Sigma)in 25 mcl final volume. Thermocycling conditions were 30 s at 94 C, followed by 30 cycles of (94 ?C for 30 s, 57.5 C for 30 s and 72 C for 30 s) and an extension step at 72 C for 7 min.
Primer 1PacC25.forward primer: GTGTTTTGACAAGAAATGAATTG
Primer 2PacC25.reverse primer: TCCATTCGCAGTAAAATTAAAC
Product Length193/205
PolymorphismP_ PacC25
Publication[view all]
Germplasm
Stock NameType
Stark Early Orangeaccession