PacC3 (genetic_marker) Prunus armeniaca

Marker Overview
NamePacC3
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
GermplasmStark Early Orange
Source TypecDNA
Repeat Motif(GA)16
PCR Condition2 mM of MgCl2, 0.1 mM of each dNTP, 0.2 mcM of each primer, 1? Buffer and 0.5 units of Taq polymerase (Sigma)in 25 mcl final volume. Thermocycling conditions were 30 s at 94 C, followed by 30 cycles of (94 ?C for 30 s, 57.5 C for 30 s and 72 C for 30 s) and an extension step at 72 C for 7 min.
Primer 1PacC3.forward primer: TGACTTGATCAGACTCGACA
Primer 2PacC3.reverse primer: TTGCATTTGCATTTACAATAGA
Product Length164/166
PolymorphismP_ PacC3
Publication[view all]
Germplasm
Stock NameType
Stark Early Orangeaccession