|
|
Marker Overview
| Name | SNP_IGA_390559 |
|---|
| dbSNP ID | N/A |
|---|
| SNP Array ID | | IRSC 9K SNP array for peach: | SNP_IGA_390559 | | IRSC 16K SNP array for peach: | SNP_IGA_390559 |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | [T/G] |
|---|
| Species | Prunus persica |
|---|
| Source Type | WGS |
|---|
| Primer 1 | SNP_IGA_390559_LEFT_primer_0: ATGTAGCCAGAGACCCAGACAT |
|---|
| Primer 2 | SNP_IGA_390559_RIGHT_primer_0: CCAAAATCTATAGGCTCAACCG |
|---|
| Product Length | 259 |
|---|
| Publication | [view all] |
|---|
| Contact | Ksenija Gasic
|
|---|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
| Year | Publication |
|---|
| 2012 | Verde I, Bassil N, Scalabrin S, Gilmore B, Lawley CT, Gasic K, Micheletti D, Rosyara UR, Cattonaro F, Vendramin E, Main D, Aramini V, Blas AL, Mockler TC, Bryant DW, Wilhelm L, Troggio M, Sosinski B, Aranzana MJ, Arús P, Iezzoni A, Morgante M, Peace C. Development and evaluation of a 9K SNP array for peach by internationally coordinated SNP detection and validation in breeding germplasm. PloS one. 2012; 7(4):e35668. |
Sequence
>SNP_IGA_390559 ID=SNP_IGA_390559; Name=SNP_IGA_390559; organism=Prunus persica; type=genetic_marker; length=121bp
TGATGGCAATAAGCTGTTCGGTGTTGAACTTTGCTTACCCCATCCTTCTT
CAAACAAACAKTCAATAAACTTTTCAAAAACTGAAATTGTCAAGGATTCA
GGTGTAAACATATCCTTGACT
|
