UDP-018 (genetic_marker) Prunus persica | GDR

Marker Overview

Marker Overview


Name	UDP-018
Genbank ID	N/A
Type	SSR
Species	Prunus persica
Germplasm	Redhaven
Source Type	Genomic
Repeat Motif	CT and GT
Primer 1	UDP-018.Forward Primer: TTCTAATCTGGGCTATGGCG
Primer 2	UDP-018.Reverse Primer: GAAGTTCACATTTACGACAGGG
Product Length	242-282
Polymorphism	P_ UDP-018
Publication	[view all]
Contact	R. Testolin Maria Badenes

Contact

Name

Details

R. Testolin

First name:	Raffaele
Last name:	Testolin
Institution:	University of Udine, Italy
Address:	Dipartimento di Scienze Agrarie e Ambientali University of Udine Via delle Scienze 208 I-33100 Udine, Italy
Country:	Italy
Email:	raffaele.testolin@uniud.it
Phone:	0432 558632

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Pp01	chromosome	Pp01:1298857..1299112 .	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)	GDR marker alignment to genome using primer sequences
PAV01_REGINA	chromosome	PAV01_REGINA:1447378..1447618 .	Prunus avium Regina Genome v1.0 Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr_1	chromosome	chr_1:5654117..5654357 .	Prunus avium Tieton Genome v2.0 Assembly & Annotation	GDR marker alignment to genome using primer sequences
Pd01	chromosome	Pd01:18252132..18252360 .	Prunus dulcis Lauranne Genome v1.0	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
1999	Theoretical and applied genetics. Theor. appl. genet. July 1999. v. 99 (1/2) p. 65-72. ISSN 0040-5752; THAGA6
2005	Scientia Horticulturae, 103: 305?315
2000	Testolin R, Marrazzo T, Cipriani G, Quarta R, Verde I, Dettori MT, Pancaldi M, Sansavini S. Microsatellite DNA in peach (Prunus persica L. Batsch) and its use in fingerprinting and testing the genetic origin of cultivars. Genome / National Research Council Canada = Génome / Conseil national de recherches Canada. 2000 Jun; 43(3):512-20.

Germplasm


Stock Name	Type
Redhaven	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-JF-F2	G1	N/A	7.2	UDP-018	View
2	Peach-PF-BC1-2005	G1	N/A	0	UDP-018	View
3	Peach-SP-F2-2003	1	N/A	2	UDP-018	View
4	Apricot-integrated-Goldrich-2011	LG1	N/A	3.9	UDP96018	View
5	Chokecherry-RCxSC-F1-2014	SC IVc	N/A	23.3	UDP96-18-1	View
6	Chokecherry-RCxSC-F1-2017	Cho-3	N/A	6.21	UDP96-18-1	View
7	Chokecherry-RCxSC-F1-2014	SC IVc	N/A	29	UDP96-18-2	View
8	Chokecherry-RCxSC-F1-2017	Cho-3	N/A	0	UDP96-18-2	View