cd195 (genetic_marker) Prunus armeniaca | GDR

Marker Overview

Marker Overview


Name	cd195
Genbank ID	N/A
Type	SSR
Species	Prunus armeniaca
Primer 1	cd195.Forward Primer: CCTCTGATGTATTATCTTTCTGGC
Primer 2	cd195.Reverse Primer: TTTCAACAGCTCCAAATTCAC
Publication	[view all]
Contact	Maria Badenes

Contact

Name

Details

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2008	Sicard O, Marandel G, Soriano JM, Lalli DA, Lambert P, Salava J, Badenes ML, Abbott AG, Decroocq V. Flanking the major Plum pox virus resistance locus in apricot with co-dominant markers (SSRs) derived from candidate resistance genes. Tree Genetics and Genomes. 2008; 4(2):359-365.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Peach-SP-F2-2009	G1	N/A	61.1	cd195	View

Alignments

Feature Name	Type	Location	Analysis
Pp01	chromosome	Pp01:18897234..18897423.	Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)