ARSFL092 (genetic_marker) Fragaria ananassa | GDR

Marker Overview

Marker Overview


Name	ARSFL092
Genbank ID	N/A
Type	SSR
Species	Fragaria x ananassa
Repeat Motif	17mer
Primer 1	ARSFL092.Forward: tccggtgacgaatctaaagg
Primer 2	ARSFL092.Reverse (no gttt): gaagaacaagcaccaccaca
Publication	[view all]
Contact	Eric van de Weg
Comment	c: present in one parent only (1:1 segregation), h: heterozyogous (1:3 segregation), d: distorted c markers, y:distorted h markers

Contact

Name

Details

Eric van de Weg

First name:	Eric
Last name:	van de Weg
Title:	researcher
Institution:	Wageningen-UR Plant Breeding, Wageningen University and Research Centre
Address:	P.O. Box 16, 6700 AA Wageningen, The Netherlands
Country:	The Netherlands
Email:	eric.vandeweg@wur.nl
Keywords:	allo-octoploid strawberry

Publications


Year	Publication
2005	Lewers KS, Styan SMN, Hokanson SC, Bassil NV. Strawberry GenBank-derived and genomic simple sequence repeat (SSR) markers and their utility with strawberry, blackberry, and red and black raspberry. Journal of the American Society for Horticultural Science. 2005; 130(1):102-115.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Strawberry-232x1392-F1	I-1	N/A	39.49	ARSFL092-183	View
2	Strawberry-232x1392-F1	I-F.1	N/A	39.7	ARSFL092	View
3	Strawberry-232x1392-F1	I-M.1b	N/A	0	ARSFL092	View
4	Strawberry-232x1392-F1-2012	I-F.1	N/A	39.7	ARSFL092	View
5	Strawberry-232x1392-F1-2012	I-M.1b	N/A	0	ARSFL092	View
6	Strawberry-HK-F1	LG1A	N/A	23	ARSFL092	View
7	Strawberry-HK-F1	LG1B	N/A	35	ARSFL092	View
8	Strawberry-HK-F1	LG1C	N/A	36.2	ARSFL092	View
9	Strawberry-HK-F1	LG1D	N/A	24	ARSFL092	View
10	Strawberry-232x1392-F1-2015	LGI-1	N/A	55.52	ARSFL92-183h	View