|
|
Marker Overview
| Name | BFACT036 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Fragaria x ananassa |
|---|
| Source Type | cDNA |
|---|
| Repeat Motif | Direct |
|---|
| PCR Condition | Final reaction volume of 12.5ul comprising 1.5ul template DNA, 1x PCR buffer, 1.5mM Mg2+, 200 M dNTPs, 0.2uM each primer and 0.25U Taq polymerase. PCR cycles: initial denaturation step of 94oC (2min), then 10 cycles of 94oC (30s), 55-50oC annealing temperature decreasing by 0.5oC per cycle (45s) and 72oC (1min), followed by 25 cycles of 94oC (30s), 50oC (45s) and 72oC (1min), and a final elongation step of 72oC (5min) |
|---|
| Primer 1 | BFACT036.Forward: TGCAAGCTGACAAACAGAAAA |
|---|
| Primer 2 | BFACT036.Reverse (no gttt): TCGGATCGATGTTACTTTCAGA |
|---|
| Publication | [view all] |
|---|
| Contact | D. Sargent
Eric van de Weg
|
|---|
| Comment | c: present in one parent only (1:1 segregation), h: heterozyogous (1:3 segregation), d: distorted c markers, y:distorted h markers |
|---|
Publications
| Year | Publication |
|---|
| 2006 | Sargent DJ, Clarke J, Simpson DW, Tobutt KR, Arús P, Monfort A, Vilanova S, Denoyes-Rothan B, Rousseau M, Folta KM, Bassil NV, Battey NH. An enhanced microsatellite map of diploid Fragaria. Theoretical and Applied Genetics. 2006 May; 112(7):1349-1359. |
| 2008 | Rousseau-Gueutin M, Lerceteau-Köhler E, Barrot L, Sargent DJ, Monfort A, Simpson D, Arús P, Guérin G, Denoyes-Rothan B. Comparative genetic mapping between octoploid and diploid Fragaria species reveals a high level of colinearity between their genomes and the essentially disomic behavior of the cultivated octoploid strawberry. Genetics. 2008 Aug; 179(4):2045-60. |
|
