BFACT018 (genetic_marker) Fragaria ananassa | GDR

Marker Overview

Marker Overview


Name	BFACT018
Genbank ID	N/A
Type	SSR
Species	Fragaria x ananassa
Repeat Motif	17mer
Primer 1	BFACT018.Forward: AGGATCGGAGAACAGCAGAG
Primer 2	BFACT018.Reverse (no gttt): CTCCCTCCTCTCCAACTGTG
Publication	[view all]
Contact	Eric van de Weg
Comment	c: present in one parent only (1:1 segregation), h: heterozyogous (1:3 segregation), d: distorted c markers, y:distorted h markers

Contact

Name

Details

Eric van de Weg

First name:	Eric
Last name:	van de Weg
Title:	researcher
Institution:	Wageningen-UR Plant Breeding, Wageningen University and Research Centre
Address:	P.O. Box 16, 6700 AA Wageningen, The Netherlands
Country:	The Netherlands
Email:	eric.vandeweg@wur.nl
Keywords:	allo-octoploid strawberry

Publications


Year	Publication
2008	Rousseau-Gueutin M, Lerceteau-Köhler E, Barrot L, Sargent DJ, Monfort A, Simpson D, Arús P, Guérin G, Denoyes-Rothan B. Comparative genetic mapping between octoploid and diploid Fragaria species reveals a high level of colinearity between their genomes and the essentially disomic behavior of the cultivated octoploid strawberry. Genetics. 2008 Aug; 179(4):2045-60.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Strawberry-232x1392-F1	VII-1a	N/A	6.62	BFACT018-220	View
2	Strawberry-HK-F1	LG7A	N/A	62	BFACT018	View
3	Strawberry-HK-F1	LG7B	N/A	39.2	BFACT018	View
4	Strawberry-HK-F1	LG7C	N/A	32	BFACT018	View
5	Strawberry-HK-F1	LG7D	N/A	47	BFACT018	View
6	Strawberry-232x1392-F1-2015	LGVII-4	N/A	37.43	BFACT018-220h	View