Citric acid, qCIT.JF-ch5.2 (QTL) Prunus persica

QTL Overview
QTL LabelqCITA.JF-ch5.2
Published SymbolCit
Trait Namecitric acid content
Trait AliasN/A
Trait StudyPeach fruit quality trait-Dirlewanger-1999
PopulationFerjalou_Jalousia_x_Fantasia-F2
Female ParentFerjalou_Jalousia
Male ParentFantasia
Colocalizing MarkerN/A
Neighboring MarkerAC9
EnvironmentN/A
LOD14
Additivity Dominance RatioN/A
R2N/A
CommentsN/A
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Peach-JF-F2G5N/AN/A9--View
Alignments
Feature NameTypeLocationAnalysis
Pp05 chromosome Pp05:8753765..8754191. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
scaffold_5 supercontig scaffold_5:8752877..8753303. Prunus persica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

QTL from alignment at Pp05:8753765..8754191

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qCITA.JF-ch5.2 ID=qCITA.JF-ch5.2; Name=citric acid content; organism=Prunus persica; type=QTL; length=427bp; location=Sequence derived from: Pp05:8753765..8754191 (Prunus persica
AGTTAAGCAAATTAAATTATATTAGTTTCCAAAAAGATTACATAAATAGA AACATCATTAACTTAAACTTATTCATAATAATCACCCCATGTGGAAACCG CCATAACAAAGGAAACGAGAAATTCCCACTTACACTCACACAATACAAAC AATTTCAAGCCAGAAGATAATAACAAAGAGAAATATAAAGCACAAAGATG ATCGAACAAATGGCTATTGTCGTTTTAGGCACATTGGAAATCTTTAGGAA CCTTATTGCCGCAAACATTAAGAAGCAAGCTCAGAGAAATTGGAATGTTG AGGTTGATTCCCAAAATGTTGGCTTTGATCGCAGTGCAGAGGCACACAGC AGCTTCAACATCAGCAAGGCCTTGGATGAGACTGCAGCAAGGCGCTACAG GAGGTTTACCAATGGTGATGTTAAGCA
back to top

QTL from alignment at scaffold_5:8752877..8753303

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qCITA.JF-ch5.2 ID=qCITA.JF-ch5.2; Name=citric acid content; organism=Prunus persica; type=QTL; length=427bp; location=Sequence derived from: scaffold_5:8752877..8753303 (Prunus persica
AGTTAAGCAAATTAAATTATATTAGTTTCCAAAAAGATTACATAAATAGA AACATCATTAACTTAAACTTATTCATAATAATCACCCCATGTGGAAACCG CCATAACAAAGGAAACGAGAAATTCCCACTTACACTCACACAATACAAAC AATTTCAAGCCAGAAGATAATAACAAAGAGAAATATAAAGCACAAAGATG ATCGAACAAATGGCTATTGTCGTTTTAGGCACATTGGAAATCTTTAGGAA CCTTATTGCCGCAAACATTAAGAAGCAAGCTCAGAGAAATTGGAATGTTG AGGTTGATTCCCAAAATGTTGGCTTTGATCGCAGTGCAGAGGCACACAGC AGCTTCAACATCAGCAAGGCCTTGGATGAGACTGCAGCAAGGCGCTACAG GAGGTTTACCAATGGTGATGTTAAGCA
back to top