COB, COB (gene) Fragaria mandshurica

Gene Overview
Name COB
Gene Symbol COB
Type gene
Organism Fragaria mandshurica
Synonym cytochrome b
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKP824837.1-COBFragaria mandshuricagene
COBKC825236.1-COBFragaria mandshuricagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
COBKP824837.1-COB.m1Fragaria mandshuricamRNA
COBKC825236.1-COB.m1Fragaria mandshuricamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cytochrome bCOBFragaria mandshuricagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KP824837.1-COB N/A KP824837.1
gene parsed from NCBI nr database KC825236.1-COB N/A KC825236.1
mRNA parsed from NCBI nr database KP824837.1-COB.m1 N/A KP824837.1
mRNA parsed from NCBI nr database KC825236.1-COB.m1 N/A KC825236.1

Sequence(s):
>KP824837.1-COB1308
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagccgaaattagagctagaaacgccttatttcgtttcgttcc
cgttcttcatttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactat
tctttcgtactctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaaca
cttcggcctaacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgg
gcctgtagctttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctc
tcgccttaccaacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttca
catggaggagtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgccttt
gggttccgaactccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattcca
tttgtggaaatttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgcc
gacgtgttgccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcg
cgaacataataatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggcta
tacatacaaatctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccata
atgaaactgccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtca
gctccaaaaggataagttgcgttggaat
back to top
>KC825236.1-COB1167
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcaacatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtgcgttagctggtctttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgag
back to top
>KP824837.1-COB.m11308
atggtccaactacataactttttctttttcattacttccatggtcgtgccttgtggcacggcagcacccgtactattgaa
atggtttgtcagtagagatgttcccacaggtgcccctttttccaatggtactataattcctattcctatccctgcattcc
ctcttttgatctatatacattccaggaaattcatacgctccatggacggagcaaaaagtggagtcttggtcagagcaagc
cgccctattttattaccagacataattgagagaagctcagccgaaattagagctagaaacgccttatttcgtttcgttcc
cgttcttcatttccttcttctcgcatacaagggggacttatcatatttagaatctctctgcggtgtgctctgtttactat
tctttcgtactctcttctctttaccacgcgataggtcgtcagcgaagcgtgagcgggcgcggagaaggaaacgccaaaca
cttcggcctaacgggaatgagcaacgacgaaatgacaagatgaggtgctccgggcacccccgaagggtcgaaggttttgg
gcctgtagctttccccgcccccccttcgtcggatggtgcttgtggggggcgtgtgccaccagaaatagggcttgaagctc
tcgccttaccaacgagccgacagctgatggctgttggtcacgactactaccaaaaagctccaatgaagatgaatatttca
catggaggagtgtgcatctgtatgttgggtgttcttctgtctaacacaaagaagatacagttcactcaacgattgccttt
gggttccgaactccttatggggaaggagcgttgttgtttgcgaggtctcgatcatttacatggacccacttctcattcca
tttgtggaaatttgatgatctataaaccgtccctaacgaacgatcggctcatgtttgagcatgatgaatcactgcgtgcc
gacgtgttgccaataagctttccggcctcatatgagaatggaaaactggagcattttctgcatcggtggatgaagaatcg
cgaacataataatttctggttgaccatgttcccagaaaaaagatactttcgagaaacgacgagcacgaccgaagtggcta
tacatacaaatctatttacggatctatatgcttcgattggaactggaagttccagaacaggcggctggtataccaccata
atgaaactgccttttattttttttattcggataggatttatgttggcttcgtcgggaggctcgcgtagtttgttacgtca
gctccaaaaggataagttgcgttggaat
back to top
>KC825236.1-COB.m11167
atgactataaggaaccaacgattctctcttcttaaacaacctatatcctccacactaaatcaacatttgatagattatcc
aaccccgagcaatcttagttattggtgggggttcggtgcgttagctggtctttgtttagtcattcagatagtgactggcg
tttttttagctatgcattacacacctcatgtggatctagctttcaacagcgtagaacacattatgagagatgttgaaggg
ggttggttgctccgttatatgcatgctaatggggcaagtatgtttctcattgtggttcaccttcatatttttcgcggtct
atatcatgcgagttatagcagtcctagggaatttgtttggtgtctcggagttgtaatcttcctattaatgattgtgacag
cttttacaggatacgtactaccttggggtcagatgagcttttggggagctacagtaattacaagcttagctagcgccata
cctgtagtaggggataccatagtgacttggctttggggcggtttctccgtggacaatgccaccttaaatcgtttttttag
tcttcatcatttactcccctttattttagtaggcgccagtcttcttcatctggccgcattgcatcaatatggatccaata
atccattgggtgtacattcagagatggataaaatttctttttacccttatttttatgtaaaggatctagtaggttgggta
gcttttgctatctttttttccatttggattttttatgctcctaatgttttggggcatcccgacaattatatacctgctaa
tccgatgcccaccccgcctcatattgtgccggaatggtatttcctaccgatccatgccattcttcgtagtatacctgaca
aagcgggaggtgtagccgcaatagcaccagtttttatatgtctgttggctttacctttttttaaaagtatgtatgtgcgt
agttcaagttttcgccctattcaccaagcaatattttggttgcttttggcggattgcgtactactaggttggatcggatg
tcaacctgtggaggcaccatttgttactattggacaaatttctcctttagttttcttcttattctttgccataacgccca
tttcgggaaaagttggaagaggaattcctaattcttacacggatgag
back to top