SFBB, SFBB (gene) Malus fusca

Gene Overview
Name SFBB
Gene Symbol SFBB
Type gene
Organism Malus fusca
Synonym SFBB
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
SFBBKP768250.1-SFBB.m1Malus fuscamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S locus F-box brothersSFBBMalus fuscagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KP768250.1-SFBB.m1 N/A KP768250.1

Sequence(s):
>KP768250.1-SFBB.m1853
tgcatacgcaagtcttggtgtactcttatcaatagtccaagttttgtggccaaacacctcaacaattccgtggacaacaa
actatcatcctccacttgcatccttctcacacgttctcagcctcttgttttcccggacaacagttggaaaccagaagttt
tctggtccatgattaatctttccattgatagtgatgagcacaacctttattatgatgttgaggacttaagtataccgttt
cctttggaagatcatgattttgtacagattgacggttattgcaatgggattgtctgtgtaagagcatggaaaactcttca
tttggtaaatgttcttttatgtaatcctgcagcgcgggaatttagtcaacttcctccttcatgccttcttcaaccttccc
gtcccaagagaaaattccaattggaggcgatcgtcataggattgggatttggctatgattgcaaagctaaagaatacaag
gttgtgcaaattatacaaaattgtgagtattcagatgatgagcaatacaattatcatcgtattgatcttcctcacacggc
tgaggtatacaccacagctgctaactcttggagaaagatcaagattgatatatctagtggaacctatgattgttcttgtt
caacgtacttgaagggattttgttattggtttgcaaccgatggcgagaaatacatactttcattttatttaggtgatgag
atatttcgtaggatacaattgccttttaggaaagaatccgattttaagttttctaatatttttctgtgtaatgaatccat
tgcttctttttgctcttgttgcgatccaagtgatgaggattctacattatgtg
back to top