MADS15, MADS15 (gene) Malus x domestica

Gene Overview
Name MADS15
Gene Symbol MADS15
Type gene
Organism Malus x domestica
Synonym C-type MADS box protein
Description Specifies stamen and carpel formation
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS15AJ251118.1-MADS15.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AJ251118.1-MADS15.m1 Chr10:36315316..36322504
chr10:26500196..26507366
chr10:30597106..30604276
AJ251118.1

Sequence(s):
>AJ251118.1-MADS15.m1738
atggcctatgaaagcaaatccttgtccttggactctccccagagaaaattgggtaggggaaagatcgagattaagcggat
cgaaaacacaacgaatcgtcaagtgaccttctgcaagaggcgcaatgggttgctcaagaaggcctatgaactctctgtgc
tctgtgatgcagaggttgctctcatagtcttctctaaccgtggccgcctctatgagtatgccaacaatagtgttaaagga
acaattgagaggtacaagaaggcaagtgcagattcttcaaatactggatcagtttctgaagctagtactcagtactacca
gcaagaagctgcgaaattgcgtgcgcggatagtgaaattgcagaatgacaaccggaatatgatgggtgatgcattgaata
gtatgtctgtcaaggacctgaagagcctggagaataaactggagaaagcaattagcagaatccgatccaaaaagaatgag
ctcttgtttgccgaaattgagtacatgcagaaaagggaactggacttgcacaacaataaccagctcctacgagcaaagat
agctgagaatgagagggccagcagaacattaaatgtgatggccggaggaggaacttcaagctatgacatcctgcagtctc
agccatacgactctcggaactatttccaagtgaacgcgttacaacccaatcatcagtacaatccccgccacgatcagatt
tctcttcaattagtatga
back to top