MADS1, MADS1 (gene) Malus x domestica

Gene Overview
Name MADS1
Gene Symbol MADS1
Type gene
Organism Malus x domestica
Synonym MADS-box protein 1
Description cell differentiation and division|floral development
Comment MdMADS1; transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS1U78947.1-MADS1.m1Malus x domesticamRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly U78947.1-MADS1.m1 Chr17:5279812..5285746
chr17:5046861..5052593
chr17:5246861..5252593
U78947.1

Sequence(s):
>U78947.1-MADS1.m1741
atggggagaggaagagtggagctgaagaggatagagaacaagataaacaggcaagtcacatttgcaaagagaagaaatgg
gcttctgaagaaagcttatgagctctccgttctctgtgatgctgaggttgctctcatcatcttctccaaccgtggcaagc
tctatgagttttgcagcagctctagcatgctcaaaacactagacaggtaccaaaaatgcagttatggtgcagtggatcaa
gttaatagacctgcaaaggaacttgagagcagctatcgtgagtacatgaaactcaaaggtagatatgagtccctacaacg
aactcagagaaaccttcttggtgaggacttgggtccattaaacacaaaggaacttgagcagcttgagcgtcaacttgagg
gctccttgaagcaagttaggtccactaagacccagtatatgctggaccaactttctgaccttcagaacaaggaacaactg
ttaatagaagccaacagggatttgacaatgaagttggatgaaattagttcaagaaatcaacttagacaatcatgggaagg
tggtgaccagggtatggcatatgcaacccagcatcaccatgctcaatcccaaggattcttccagcctttagattgcaatc
ccactttgcaaatggggtactctgcagtggggtcagagcagatgagtgctacaactaatgcccagcaagtgaactgtttc
atccctggatggatgctttga
back to top