MADS2.1, MADS2.1 (gene) Malus x domestica

Gene Overview
Name MADS2.1
Gene Symbol MADS2.1
Type gene
Organism Malus x domestica
Synonym MdMads2.1 protein
Description NA
Comment transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS2.1DQ205652.1-MADS2.1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly DQ205652.1-MADS2.1.m1 Chr14:29952041..29957558
chr14:26876102..26881620
chr14:31494632..31500150
DQ205652.1

Sequence(s):
>DQ205652.1-MADS2.1.m1768
atggggaggggaagggtgcagctgaagagaattgagaacaagatcaacaggcaggtgaccttctcaaagagaaggtcggg
gctgatgaagaaagctcatgagatttctgtgctttgtgatgctgaggttgctttgattatcttctccaccaagggcaagc
tctttgagtactccaatgattcctgcatggaaaggatcctggaaaggtacgaaagatactcatatacagagaggcagctt
cttgcaaatgataatgaatccactggaagctggactctggaacatgcaaagctcaaggctagggtggaggttttacaaag
aaatcaaagacactatatgggagaagatctccaatccttaagtctcaaagagcttcaaaatttagagcaacagcttgatt
ctgcactgaagcacataaggtcaagaaagaaccaagttatgtacgaatcgatttctgagctccagaagaaggataaggca
ttgcaggagcaaaacaacttgctggcaaagaaggtgaaggagaaggagaacgcagtagctcaacaggcccaattggagca
tgtgcaggagcagaggttgaactcctcttcctcccttcttccacgggcattgcagtccttgaatttcggcagcgggtcca
attaccaggccattagatcaagtgaaggaataccaggagataatcagcagtatggagatgaaaccccaactccacataga
cctaacatgctgctgcccgcttggatgctccgccaccttaatgaatag
back to top