MADS5, MADS5 (gene) Malus x domestica

Gene Overview
Name MADS5
Gene Symbol MADS5
Type gene
Organism Malus x domestica
Synonym MADS domain class transcription factor
MADS-box protein 5
MADS-box protein
Description MADS box transcription factor
Comment MdMADS5
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS5DQ782960.2-MADS5Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADS5HM122609.1-MADS5.m1Malus x domesticamRNA
MADS5DQ782960.2-MADS5.m1Malus x domesticamRNA
MADS5AJ000759.1-MADS5.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSMalus x domesticagene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ782960.2-MADS5 N/A DQ782960.2
predicted genes from whole genome assembly HM122609.1-MADS5.m1 Chr16:4173245..4174202
chr16:2317077..2318034
HM122609.1
mRNA parsed from NCBI nr database DQ782960.2-MADS5.m1 chr13:3704597..3708151
chr13:3693383..3696937
DQ782960.2
predicted genes from whole genome assembly AJ000759.1-MADS5.m1 Chr16:4173188..4176422
chr16:2317020..2320254
AJ000759.1

Sequence(s):
>DQ782960.2-MADS53793
ggacgactgatatgacgctgcttacgggtccaaagagttcggcaatggtaactctaaaggccgtccgtacaaagcatgcc
cgagactctttgtgtccgaatagaagtcagtaagtagtgatctacaccagcgtgaaagaaaaataaaattgtggttccaa
ttactagccctgttggaaagagagaaaacgactgcacggtgtacctcaaccaatcagaaatcgacaacacttcttagaaa
tcccaccggttttcccaaaaccacttgtgttcacaaaaccgctttatctatcatcaaatcaaatgtgtgtatagatagct
actagcacatacactttctcagacaccttcagatatttgcttagaagaagaaatccattaatttataactgtatttcttt
ctttttgcatataaatagcacagcttagtatttcagtttctgggttgtctttcttttttggttgtttgggttttttgaga
aagaaaaacagagaacaagcagttgaaagagttgagtggcaactgagagtccataagtatttaatcatggggagaggtag
agttcagcttaagcgcatagagaacaagatcaacaggcaggtgactttttccaaaagaagaactgggctgctgaagaagg
ctcatgagatctctgtcttgtgtgatgctcaggttgctttgattgtcttctccaacaagggcaagctctttgagtacgcc
acagattcatggtatactattttattaattgattatatctcctcctctcgaattttatttactaaaacctagctaaaatt
tccaccaaagaaaaaaacctaatttttattttccgaaaatttcgaaggtacgcgagaaatttgtatctataagaaagtaa
aaggatttagaaacgttgcttgagagatcgagctaaacctagctaaaaagctttcatacaccttgctttattagtctgtt
ttgttttctgtttttgcatatttttgttttgttttctttcactacaaatttgtaattagggttgtactatatacgtgtga
tcttataatttggtcaatggttaaccctgagttgtccaaaggtagaactctgttaactataagttgattgtagatgaagt
aactggagttgttaatttttcataatctaatgctggtcaactgagatgtcgttcctgcaaggtaattagaagatcgatga
aagcggtgctgatttgatataagtattttgtaattataaaatagctagacgtacttctcttatgcttttctttttttggc
taaattacttaatgcgtgtctaaaatttagtggttgcctctgacaaaagaaacatgttgatcggtacttattttatagtt
tttcgtactaaattgaacctaacaaatgtgaagagattaaacttgcctgcttgattaaggagcgatttgctacagtataa
tatatcattactaattgtgatctttgttagtgatattaaataaaattaatggattctggaatatatggtaatgggtaagc
agaaaaatttttgtcagcaaaagtaaaaacatcaaacaaggagtggaagcagcagcaggtagaatcccagcaggagaata
tccactaacatatataatatataatacccctgagagaaagagaaggcgatggcacggaccaagtacataatatagttgga
atattgtggtttaattatagaatatctgaagtgaaatgaaaggaaaacccagaaaacgagaagcctggtgtagtaaatct
cagatatttatttaaataatacagtcttcaacagaagctcaaattatttgaagctaggcgaccattaaataggttaactt
gtcctatacataacagtatctttgctaattatatacatatagctatatattaagttactaacagtctcctagttgattat
atttacatacgcacacacactcacatctgtagtagtattggaacctgttagagatgacatgcatgcgagatgcttgctcg
actgtaaaccgaaaacaagaataaaaagtgcaagactattgcaactccaaggtttgtactgcctggcattgattgtaatt
taatcaacattatttcatgtgatgatgatcatgattaattttcttaatcatatgaatatactccattcaaagtgttttca
taacttcaatcaaattattaatcaatcaattcattaagatggggttttttgatagaggagcaggttgcattcttctatct
agatactatttactacttttcatatgtttgatattgctgatcatgcatgtacagcatggagcaaatcctcgaacgctatg
aaagatactcttacgccgaaagacagctagtcgaaccagattttgagtcacaggtttgccatgccatgccatcaatctcc
gaatactaattaactgctacgccttattttgatagtgttataactaattactcgaacaatttcatgatgcgcagggtaac
tggacctttgaatattccagactaaaggctaaagctgaggttttgcaaagaaaccataggcactatttgggagaagacct
ggattccttgactctcaaggaaatccaaagtttggagcaacagcttgacaccgctcataaacaaattcgattaagaaaag
tacatacttattatgcttgctaacgaggatcgctttctcttaatggtgcatttgtacttacactagactaattttgagtt
tgatgacgctaaagtattctcttaacttctttcagaatcaactcatgcatgaatccatcactgagcttcagagaaaggtt
agggcacctatagcatgtttttcccgttgtgaatatgtttagactctgcgagagaaagagaaatggtactgtgtgtcata
tattttacgtggctcatttaattgttttttatctttttgtgtcgtgcaggaaaaggcgatacaggagcaaaataacttgc
tagcaacgaaggtaataatatgcttatactattttatcacatagtcaaatagggttgtagtctagggtttatatttgcct
ttaacttggatggttttttatgtgatgattcttcttttcggttttctgtttttcatttaaattttggaaatagatgaagg
agaaggagaaggctgcagctcagccccaggttcaaaactgggagcagcagaaccatgaccttgacctgcttccacagccc
cttccatgtcttaacattgggtgattattcttcccacataaaattcttaattctagggcctgttaatttgtcttgtttta
ttagagcaatttcaatggaaaagatgcagctttgagatgtaaaaatcacatttacattacatataattttgggaaatcta
aatgtagttgttgctccaatgtgaagatgtaaatttcacttacagaaaaaaaaaaaaaaaaaaaagcagatgaaactttc
atcttcaggtcaagatgcgtacttaaatcccctcaaaattataattggagagcattctggccaataagagatgtatatgt
gctacacatcaggagatgctcttagcatgttaatattgttttatagaaaatctgtttgaccacactgacaatagtgatga
atcagttaagaagttaattaacttggtatcaacgaccctaattaacttgtttatatgcaatgcatagtctgatacgatat
gatatgcagggggacgcagcaagatgaattccttcaagtgaggaggaaccagctggaccttacactggaaccattttatt
catgccatctcggatgctttgctgcttgatcat
back to top
>HM122609.1-MADS5.m1225
atgaatgaatccatctctgagcttcagagaaagagaaaggcgatacaggaggaaaataacttgctagcaaagaagataaa
ggagaaggagaaggctgcagctcagccccaggttcaaaactgggagcagcagaaccatggccttgacctgcttccacagc
cacttccatgtctaaacaatggggggacgcagcaagatgaattccttcaagtgaggaggaactag
back to top
>DQ782960.2-MADS5.m1720
atggggagaggtagagttcagcttaagcgcatagagaacaagatcaacaggcaggtgactttttccaaaagaagaactgg
gctgctgaagaaggctcatgagatctctgtcttgtgtgatgctcaggttgctttgattgtcttctccaacaagggcaagc
tctttgagtacgccacagattcatgcatggagcaaatcctcgaacgctatgaaagatactcttacgccgaaagacagcta
gtcgaaccagattttgagtcacagggtaactggacctttgaatattccagactaaaggctaaagctgaggttttgcaaag
aaaccataggcactatttgggagaagacctggattccttgactctcaaggaaatccaaagtttggagcaacagcttgaca
ccgctcataaacaaattcgattaagaaaaaatcaactcatgcatgaatccatcactgagcttcagagaaaggaaaaggcg
atacaggagcaaaataacttgctagcaacgaagatgaaggagaaggagaaggctgcagctcagccccaggttcaaaactg
ggagcagcagaaccatgaccttgacctgcttccacagccccttccatgtcttaacattggggggacgcagcaagatgaat
tccttcaagtgaggaggaaccagctggaccttacactggaaccattttattcatgccatctcggatgctttgctgcttga
back to top
>AJ000759.1-MADS5.m1720
atggggagaggtagagttcagcttaagcgcatagagaacaagatcaacaggcaggtgactttttccaaaagaagaactgg
gctgctgaagaaggctcatgagatctctgtcttgtgtgatgctcaggttgctttgattgtcttctccaacaagggcaagc
tctttgagtacgccacagattcatgcatggagcaaatcctcgaacgctatgaaagatactcttacgccgaaagacagcta
gtcgaaccagattttgagtcacagggtaactggacctttgaatattccagactaaaggctaaggctgaggttttgcaaag
aaaccataggcactatttgggagaagacctggattccttgactctcaaggaaatccaaaatttggagcaacagcttgaca
ccgctcttaaacaaattcgattaagaaaaaaccaactcatgaatgaatccatctctgagcttcagagaaagagaaaggcg
atacaggaggaaaataacttgctagcaaagaagataaaggagaaggagaaggctgcagctcagccccaggttcaaaactg
ggagcagcagaaccatggccttgacctgcttccacagccacttccatgtctaaacaatggggggacgcagcaagatgaat
tccttcaagtgaggaggaaccagctggacctgactctggaaccattatatgaatgccatctcggatgctttgctgcttga
back to top