MADS, MADS (gene) Prunus dulcis

Gene Overview
Name MADS
Gene Symbol MADS
Type gene
Organism Prunus dulcis
Synonym MADS-box protein
Description NA
Comment transcription factor
Evidence for the gene structure imported from NCBI
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
MADSAY313211.1-MADS.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
MADS-box proteinMADSPrunus dulcisgene_class


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY313211.1-MADS.m1 scaffold_1:22775666..22779939
AY313211.1

Sequence(s):
>AY313211.1-MADS.m1746
agaggattgagaacaagatcaacaggcaggtgacctttgcgaagcgaaggaacgggcttttgaagaaagcctacgagctt
tccgttctttgtgaggctgaggttgctctcatcatcttctccaatagaggaaagctgtacgagttttgcagtagctcaag
catgctcaaaactcttgagaggtaccagaagtgcaactatggagcaccagagacaaatgtatctgcaagggaggccttgg
aattgagtagccagcaggagtatttgaagctcaaggcacgttatgaagccctacaacgaaaccaaaggaatcttcttgga
gaagatcttggccctttaagcagcaaagagcttgaatcacttgaaaggcagctggatatgtctctgaagcagatcagatc
gacacggacccaatgcatgctggatcagctcacagatcttcagcgaaaggagcacatgctaaatgaagcaaataagaccc
tgaaacaaaggttgtttgagggataccatgtaaattcactccaaatgaatccaaatgctgacgagtacggccggcaacaa
actcaagctcatggcgatggcttcttccatcccttagactgcgagcccacgttacagattggataccagaacgatccaat
atcagtggtcacagcaggtncaagcgtgagtaattacatggcanggatggttgccatgataataanaaagtgtgttttgg
agagcaccnccagccatgaatggtaa
back to top